Table 1. Information on tested genes, primer and target/amplicon for RT-qPCR.
| Gene acronym | Gene name (Homo sapiens) | Gene function | Accession Number (NCBI GeneBank) | Chromosomal location (length) | 5´-forward primer-3´ (length / Tm / %GC / max. ΔG Hairpin&Self-Dimer / Self-Comp. / Self-3’-Comp.) | 5´-reverse primer-3´ (length / Tm / %GC / max. ΔG Hairpin&Self-Dimer / Self-Comp. / Self-3’-Comp.) | Primer Location (max. ΔG Cross-Dimer) | Amplicon (length, %GC, Tm, SSAT) | Amplicon location (bp of Start/Stop) | Intron-flanking (length) | In silico qPCR specifity | Variants targeted |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| EEF1A1 | eukaryotic translation elongation factor 1 alpha 1 | enzymatic delivery of aminoacyl tRNAs to ribosome | NM_001402.5 | 6q14.1 (3528bp) | CCTGCCTCTCCAGGATGTCTAC (22bp / 64.0°C / 59.1% / -3.0 / 5 / 2) | GGAGCAAAGGTGACCACCATAC (22bp / 62.1°C / 54.6% / -3.2 / 6 / 2) | exon 5/6 (-2.9) | 105bp, 52.4%,86.5°C, no SSAT | 804/908 | Yes (87bp) | Yes (BLAST/UCSC) | Yes |
| GAPDH | glyceraldehyde-3-phosphate dehydrogenase | enzyme in glycolysis and gluconeogenesis | NM_002046.5 | 12p13.31 (1421bp) | TGCCCTCAACGACCACTTTG (20bp / 59.4°C / 55.0% / -0.7 / 3 / 2) | CCACCACCCTGTTGCTGTAG (20bp / 61.4°C / 60.0% / 0.0 / 4 / 2) | exon 8/9 (-2.4) | 74bp,50.0%,84.0°C, no SSAT | 1091/1164 | Yes (104bp) | Yes (BLAST/UCSC) | Yes |
| POLR2A | polymerase (RNA) II (DNA directed) polypeptide A, 220kDa | transcription of DNA into mRNA | NM_000937.4 | 17p13.1 (6738bp) | TCGCTTACTGTCTTCCTGTTGG (22bp / 60.3°C / 50.0% / 0.0 / 3 / 0) | TGTGTTGGCAGTCACCTTCC (20bp / 59.4°C / 55.0% / -1.3 / 3./ 3) | exon 21/22 (-2.5) | 108bp, 53.7%,87.8°C, no SSAT | 3798/3905 | Yes (468bp) | Yes (BLAST/UCSC) | Yes |
| PPIB | peptidylprolyl isomerase A (cyclophilin B) | ER cyclosporine-binding protein | NM_000942.4 | 15q21-q22 (1045bp) | TTCCATCGTGTAATCAAGGACTTC (24bp / 59.3°C / 41.7% / -1.3 / 4 / 2) | GCTCACCGTAGATGCTCTTTC (21bp / 59.8°C / 52.4% / -0.7 / 4 / 0) | exon 3/4 (-2.1) | 88bp, 53.4%,86.1°C, no SSAT | 446/533 | Yes (3194bp) | Yes (BLAST/UCSC) | Yes |
| RNA18S | 18S ribosomal 5 | ribosomal RNA, translation of mRNA in protein | NR_003286.2 | 22p12 (1869bp) | AACTGCGAATGGCTCATTAAATC (23bp / 57.1°C / 39.1% / -1.7 / 6 / 3) | GCCCGTCGGCATGTATTAG (19bp / 58.8°C / 57.9% / -2.4 / 5 / 1) | - (-2.4) | 103bp, 46.6%,83.7°C, no SSAT | 84/186 | No (rRNA) | No (RNA45S5 also targeted) | - |
| RPL22 | ribosomal protein L22 | translation of mRNA in protein | NM_000983.3 | 1p36.31 (2099bp) | TGATTGCACCCACCCTGTAG (20bp / 59.4°C / 55.0% / -3.4 / 4 / 2) | GGTTCCCAGCTTTTCCGTTC (20bp / 59.4°C / 55.0% / -3.0 / 4 / 0) | exon 2/3 (-1.5) | 98bp, 44.9%,83.8°C, no SSAT | 115/212 | Yes (4597bp) | Yes (BLAST/UCSC) | Yes |
| RPLP0 | ribosomal protein, large, P0 | translation of mRNA in protein | NM_001002.3 | 12q24.2 (1229bp) | GAAACTCTGCATTCTCGCTTCC (22bp / 60.3°C / 50.0% / -3.4 / 4 / 0) | GACTCGTTTGTACCCGTTGATG (22bp / 60.3°C / 50.0% / -2.0 / 4 / 0) | exon 6/7 (-1.8) | 120bp, 50.8%,86.5°C, no SSAT | 803/921 | Yes (1091bp) | Yes (BLAST/UCSC) | Yes |
| TBP | TATA-box-binding protein | general transcription factor | NM_003194.4 | 6q27 (1921bp) | CGGCTGTTTAACTTCGCTTCC (21bp / 59.8°C / 52.4% / -0.8 / 5 / 0) | TGGGTTATCTTCACACGCCAAG (22bp / 60.3°C / 50.0% / -1.5 / 3 / 2) | exon 1/2 (-2.4) | 86bp, 51.2%,85.6°C, no SSAT | 79/164 | Yes (2418bp) | Yes (BLAST/UCSC) | Yes |
| YWHAZ | tryptophan 5-monooxygenase activation protein, zeta | signal transduction, | NM_003406.3 | 8q23.1 (3003bp) | AGGAGATTACTACCGTTACTTGGC (24bp / 61.0°C / 46% / 0.0 / 4 / 2) | AGCTTCTTGGTATGCTTGTTGTG (23bp / 58.9°C / 43% / -3.0 / 4 / 0) | exon 8/9 (-2.2) | 91bp, 47.3%,84.0°C, no SSAT | 504/572 | Yes (617bp) | Yes (BLAST/UCSC) | Yes |
| COX2 | cyclooxygenase 2 | prostaglandin synthesis | NM_000963.3 | 1q25.2–25.3 (4507bp) | GAGCAGGCAGATGAAATACCAGTC (24bp / 64.0°C / 50.0% / 0.0 / 2 / 2) | TGTCACCATAGAGTGCTTCCAAC (23bp / 63.1°C / 47.8% / -1.3 / 4 / 0) | exon 8/9 (-3.2) | 131bp, 42.0%,82.9°C, no SSAT | 1457/1587 | Yes (486bp) | Yes (BLAST/UCSC) | Yes |
| IL6 | interleukin 6 | proinflammatory reaction | NM_000600.3 | 7p21 (1201bp) | TGGCAGAAAACAACCTGAACC (21bp / 61.7°C / 47.6% / -1.1 / 3 / 0) | CCTCAAACTCCAAAAGACCAGTG (23bp / 62.2°C / 47.8% / -0.8 / 3 / 3) | exon 2/3 (-1.5) | 117bp, 43.6%,83.7°C, no SSAT | 370/486 | Yes (704bp) | Yes (BLAST/UCSC) | Yes |
| COL1A2 | collagen, type I, alpha 2 | encodes for collagen I type alpha 2 | NM_000089.3 | 7q22.1 (5411bp) | AGAAACACGTCTGGCTAGGAG (21bp / 61.9°C / 52.4% / -3.3 / 4 / 2) | GCATGAAGGCAAGTTGGGTAG (21bp / 62.0°C / 52.4% / -2.3 / 5 / 0) | exon 50/51 (-0.7) | 105bp, 44.8%,83.3°Cno SSAT | 4139/4243 | Yes (710bp) | Yes (BLAST/UCSC) | Yes |
| P4HA1 | prolyl 4-hydroxylase, alpha polypeptide I | key enzyme in collagen synthesis | NM_000917.3 | 10q22.1 (2860bp) | GCTCTCTGGCTATGAAAATCCTG (23bp / 60.6°C / 47.8% / 0.0 / 2 / 2) | GTGCAAAGTCAAAATGGGGTTC (22bp / 58.4°C / 45.5% / -3.4 / 4 / 0) | exon 13/14 (-0.9) | 146bp, 41.1%,82.2°C, no SSAT | 1396/1541 | Yes (13371bp) | Yes (BLAST/UCSC) | Yes |
ER = endoplasmic reticulum; Tm = melting temperature of primer/specific qPCR product (amplicon); %GC = guanine/cytosine content; bp = base pairs; Comp. = Complementarity; SSAT = secondary structure at annealing temperature.