Antibodies |
Actin |
Cell signaling |
4970S |
Cyclophilin B |
Proteintech |
11607-1-AP |
LKB1 |
Cell signaling |
3047S |
E-cadherin |
Cell signaling |
3195P |
Vimentin |
Cell Signaling |
5741P |
p-EGFR (Y1068) |
Cell signaling |
3777P |
Brdu |
ThermoFisher |
BDB347583 |
IDH1 |
Shanghai Genomics, Inc. |
N/A |
p-IDH1 (Y42) |
Shanghai Genomics, Inc. |
N/A |
p-IDH1 (Y391) |
R & D Systems |
Cat# MAB7049 |
Chemicals, Peptides, and Recombinant Proteins |
pemetrexed (cell line validation) |
Medchem Express |
Cat# HY-10820A |
pemetrexed (xenograft validation) |
Eli Lilly |
N/A |
[U-13C] glucose |
Cambridge Isotopes |
Cat# CLM-1396 |
[3,4-13C] glucose |
Cambridge Isotopes |
CLM-6750 |
[U-13C] glutamine |
Cambridge Isotopes |
CLM-1822 |
Puromycin |
Sigma |
Cat# P8833 |
Critical Commercial Assays |
Pierce™ BCA Protein Assay Kit |
ThermoFisher |
Cat# 23225 |
Deposited Data |
NSCLC cell line microarray data |
(Kim et al., 2016) |
GEO: GSE32036
|
NSCLC cell line mutation data |
(McMillan et al., 2018) |
described in table S4
|
NSCLC cell line RPPA data |
This paper |
described in table S4
|
NSCLC cell line methylation data |
(Walter et al., 2012) |
described in table S4
|
NSCLC cell line Erlotinib sensitivity data |
(McMillan et al., 2018) |
N/A |
NSCLC cell line Pemetrexed sensitivity data |
This paper |
described in table S4
|
Experimental Models: Cell Lines |
NSCLC cell line collection |
This paper |
described in table S4
|
Experimental Models: Organisms/Strains |
Mouse: NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJArc |
UT Southwestern |
RRID:IMSR_ARC:NSG |
Recombinant DNA |
pLKO.1 |
Open Biosystems |
N/A |
pCMVΔR8.91 |
(Cheng et al., 2011) |
N/A |
pMD2.G |
(Cheng et al., 2011) |
N/A |
MigCD8t |
(Faubert et al., 2014) |
N/A |
MigCD8t-LKB1 |
(Faubert et al., 2014) |
N/A |
Oligonucleotides |
shPC (CCGGGCCAAGGAGAACAACGTAGATCTCGAGATCTACGTTGTTCTCCTTGGCTTTTTG) |
(Cheng et al., 2011) |
N/A |
Software and Algorithms |
GC MSD Chemstation |
Agilent |
https://www.agilent.com/en/products/software-informatics/massspec-workstations/gc-msd-chemstation-software |
R Version 3.3.2 |
R Core Team, 2016 |
https://www.r-project.org/ |
Gene Set Enrichment Analysis |
(Subramanian et al., 2005) |
http://software.broadinstitute.org/gsea/downloads.jsp |
GSVA |
(Hanzelmann et al., 2013) |
https://bioconductor.org/packages/release/bioc/html/GSVA.html |
drc |
(Ritz et al., 2015) |
https://cran.r-project.org/web/packages/drc/index.html |
Other |
Fetal bovine serum |
Gemini Bio-Products |
Cat# 100-106 |
Dialyzed fetal bovine serum |
Gemini Bio-Products |
Cat# 100-108 |
Tri-Sil HTP reagent |
ThermoFisher |
N/A |
Difco™ Noble Agar |
VWR |
N/A |
ECL Western Blotting Substrate |
ThermoFisher |
Cat# 32106 |
PolyJet™ In Vitro DNA Transfection Reagent |
SignaGen Laboratories |
N/A |