REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
PE anti-mouse Ly6A/E (Sca-1) (Clone D7)	BioLegend	Cat#108107: RRID:AB_313344
BV875 anti-mouse Ly6A/E (Sca-1) (Clone D7)	BioLegend	Cat#108139: RRID:AB_2565957
APC anti-mouse CD117 (c-kit) (Clone 2B8)	BioLegend	Cat#105812; RRID:AB_313221
BV605 anti-mouse CD150 (Clone TC15-12F12.2)	BioLegend	Cat#115927; RRID:AB_11204248
APC/Cy7 anti-mouse CD48 (Clone HM48-1)	BioLegend	Cat#103431: RRID:AB_2561462
PE/Cy7 anti-mouse B220 (Clone RA3-6B2)	BioLegend	Cat#103221: RRID:AB_313004
BV785 anti-mouse B220 (Clone RA3-6B2)	BioLegend	Cat#103245: RRID: AB_11203538
BV605 anti-mouse CD19 (Clone 6D5)	BioLegend	Cat#115539: RRID:AB_11203538
BV785 anti-mouse CD19 (Clone 6D5)	BioLegend	Cat#115543: RRID:AB_11218994
BV605 anti-mouse CD11b (Clone M1/70)	BioLegend	Cat#101237: RRID:AB_11126744
PE/Cy7 anti-mouse CD11b (Clone M1/70)	BioLegend	Cat#101215: RRID:AB_312798
Alexa Fluor® 700 anti-mouse Gr-1 (Clone RB6-8C5)	BioLegend	Cat#108421: RRID:AB_493728
PE anti-mouse Gr-1 (Clone RB6-8C5)	BioLegend	Cat# 108407: RRID:AB_313372
PE/Cy7 anti-mouse Gr-1 (Clone RB6-8C5)	BioLegend	Cat#108415: RRID:AB_313380
PE/Cy7 anti-mouse CD3e (Clone 145-2C11)	BioLegend	Cat#100319: RRID:AB_312684
Alexa Fluor® 647 anti-mouse CD3e (Clone 145-2C11)	BioLegend	Cat#100324: RRID:AB_492861
PE/Cy7 anti-mouse NK-1.1 (Clone PK136)	BioLegend	Cat#108713: RRID:AB_389363
PE/Cy7 anti-mouse TER-119 (Clone TER-119)	BioLegend	Cat#116221: RRID:AB_2137789
PE/Cy7 anti-mouse CD45 (Clone 30-F11)	BioLegend	Cat#103113: RRID:AB_312978
TruStain FcX (anti-mouse CD16/32, clone 93)	BioLegend	Cat#101320: RRID:AB_1574975
Bacterial and Virus Strains
TOP10	Invitrogen	Cat#C404003
DH5α	Thermofisher	Cat#18265017
AAV-DJ	Cell Biolabs	Cat#VPK-400-DJ
AAV-6	Cell Biolabs	Cat#VPK-410-SER6
Chemicals, Peptides, and Recombinant Proteins
Mouse recombinant SCF	Peprotech	Cat#250-03
Mouse recombinant TPO	Peprotech	Cat#315-14
Mouse recombinant Flt3-ligand	Peprotech	Cat#250-31L
Human recombinant IL-11	Peprotech	Cat#200-11
StemSpanTM SFEM II	Stemcell	Cat#09655
Gentamycin	Lonza	Cat#17-519L
spCas9	IDT	Cat#1074182
spCas9	MDC Berlin, Germany	N/A
Polyethylenimine (PEI)	Polysciences	Cat#23966-1
Pluronic F-68	Thermo Scientific	Cat#24040032
OptiPrepTM Density Gradient Medium	Sigma	Cat#D1556-250ML
Benzonase® endonuclease	Millipore	Cat#70746-3
DNase	QIAGEN	Cat#79254
DAPI	Sigma	Cat#D9542-5MG
AMPure XP beads	Beckman Coulter	Cat#A63881
RNA Gel Loading Dye (2x)	Thermo Scientific	Cat#R0641
Critical Commercial Assays
Zero Blunt® TOPO® PCR Cloning Kit	Invitrogen	Cat#450245
TOPO® TA Cloning® Kit	Invitrogen	Cat# K4500-01
CloneJET PCR cloning kit	Thermo Scientific	Cat#K1232
Synthetic modified sgRNAs	Synthego	N/A
Alt-R® CRISPR sgRNAs	IDT	N/A
Alt-R® CRISPR tracrRNA	IDT	Cat#1072534
Anti-Sca-1 Microbead Kit (FITC), mouse	Miltenyi Biotec	Cat#130-092-529
TaqMan PCR master mix	Life technologies	Cat#4324018
NucleoSpin® Gel and PCR clean-up	Macherey-Nagel	Cat#740609.250
NucleoSpin® Plasmid	Macherey-Nagel	Cat#740588.250
Qiaquick® gel extraction kit	QIAGEN	Cat#28704
Herculase II Fusion DNA Polymerase	Agilent Technology	Cat# 600677
LongAmp® Taq 2X Master Mix	NEB	Cat# M0287L
CellTrace™ Violet Cell Proliferation Kit	Thermo Scientific	Cat#C34571
MethoCult GF M3434	Stemcell	Cat#03434
T7 endonuclease I assay	NEB	Cat# M0302S
Experimental Models: Cell Lines
HEK293T	ATCC	ATCC®CRL-3216
Experimental Models: Organisms/Strains
C57BL/6	Taconic	C57BL/6NTac
R26-Cas9iGFP	Chu et al., 2016b	N/A
Rag2−/− cγ−/−	Taconic	N/A
Rag2−/−	Taconic	RAGN12
Oligonucleotides
Synthetic modified sgLmnb1: 5′- GTCTTGACAAGTTCACATAA	This paper	N/A
Synthetic modified sgActb: 5′- AGTCCGCCTAGAAGCACTTG	Yao et al., 2017	N/A
Alt-R® CRISPR sg-1 to target the TK-Neo-pA: 5′- ACACGCAG ATGCAGTCGGGG	This paper	N/A
Alt-R® CRISPR sg-2 to target the TK-Neo-pA: 5′- CTGCGCTG ACAGCCGGAACA	This paper	N/A
Recombinant DNA
pAAV-DJ	Cell Biolabs	Cat#VPK-420-DJ
pAAV-DJ-Lmnb1-T2A-mCherry	This paper	N/A
pAAV-DJ-Actb-T2A-BFP	This paper	N/A
pAAV-DJ-Rag2wildtype	This paper	N/A
pAAV-Helper	Cell Biolabs	Cat#VPK-420-DJ
pAAV-DJ-Rep/Cap	Cell Biolabs	Cat#VPK-420-DJ
pAAV-6-Rep/Cap	Cell Biolabs	# VPK-426
pTV-XhoI/NotI-Lmnb1-T2A-mCherry (dsDNA)	This paper	N/A
pTV-Nb.BsrDI/NotI-Lmnb1-T2A-mCherry (ssDNA)	This paper	N/A
pTV-Nb.BsrDI/NotI-Lmnb1-T2A-mCherry (asDNA)	This paper	N/A
Software and Algorithms
Prism 7.0a	GraphPad	https://www.graphpad.com/
FlowJo 10.4.1	LLC	https://www.flowjo.com/
CrisprGold	Chu et al., 2016a, Graf et al., 2019	N/A
ICE	Synthego, Hsiau et al., 2019	https://www.synthego.com/
ImageJ	NIH imageJ	https://imagej.nih.gov/ij