Table 1.
Oligonucleotide used as primer for amplification of MPT64 gene PCR
| Gene | Primer sequence(5–3) | Product size | Reference |
|---|---|---|---|
| MPT64 forward (MTPF) | ACCGAACACTCATTTCCGC | 771 bp | In this study |
| MPT64 reverse (MTPR) | CTACTCCCGGAGGAATTTCG | 771 bp | In this study |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.