Table 1.

Nested-PCR primers used for amplification of variable regions of cattle IgG.

Primers	aSequences	bTa (°)
Ig γ chain outer-Forward:	CCCTCCTCTTTGTGCTSTCAGCCC	58/60
Ig γ chain outer-Reverse:	GTCACCATGCTGCTGAGAGA	60
Ig γ chain inner-Forward:	AGAGGRGTYBTGTCCCAGG	55
Ig γ chain inner-Reverse:	CTTTCGGGGCTGTGGTGGAGGC	55
Ig λ chain outer-Forward:	CACCATGGCCTGGTCCCCTCTG	56
Ig λ chain outer-Reverse:	AAGTCGCTGATGAGACACACC	56
Ig λ chain inner-Forward:	TGGGCCCAGGCTGTRCTG	55
Ig λ chain inner-Reverse:	GCGGGAACAGGGTGACCGAG	55

^aDegenerate bases were synthesized in these sequences, including S = C or G, Y = C or T, and R = A or G.

^bAnnealing temperature.