Table 1. Analysed DvEffector genes and primers used for qRT-PCR.
| Gene accession ID (Dv 3.2) | Annotation | Forward sequence | Reverse sequence | R2 | Primer efficiency | |
|---|---|---|---|---|---|---|
| (5'-3') | (5'-3') | |||||
| Reference gene | ||||||
| DV3000100 | actA1 | Actin A1 | TGGGGTGGTAGTGGTGATGA | ACACGTCGGATGTAAACGACA | 0,981 | 1,10 |
| DvEffectors matched with effectors of Acyrthosiphon pisum | ||||||
| DV3009058.1 | Dv1 | Protein disulfide-isomerase A3 | TCATGGCTTAGTTGGACATCGT | TTACGCCAGTAGTTGGTTCCT | 0,997 | 0,98 |
| DV3001833 | Dv2 | Peroxiredoxin-2 | AAACCAGCCCCAGATTGGAA | TTGAACGCCAATATCTCAGTTGG | 0,999 | 0,94 |
| DV3017719 | Dv3 | Venom serine carboxypeptidase-like | CAGAGCTGCGTGCAAAGTGA | ACCAAAGCAAGACAGACGCA | 0,993 | 0,93 |
| DV3010201 | Dv4 | Peroxiredoxin-2 | TGTTTTAGTGGAACCTGATGGTGT | AGCCTGAACAAGCCGTAAGAC | 0,997 | 1,09 |
| DV3014676 | Dv5 | Peroxidase | TCTGCGACAACAGTGACGAT | TGTGGAGCAGCATGACCATA | 0,997 | 0,96 |
| False positives | ||||||
| DV3014415 | Fp1 | Muscle-specific 20-like | ATTGAATATGGCGTTCCTGATGTAG | AGGGCCTAAAAATGGACCTTTCC | 0,993 | 1,02 |
| DV3008102 | Fp2 | Myofilin isoform a | CAGATCCATACCATTCTGAGCCT | TCGGGCAGAGGTAGAGGTTT | 0,993 | 0,96 |
| DV3011193 | Fp3 | Serine arginine repetitive matrix 1 isoform X1 | AGTTCAACGTCCAGCGGAAA | ACCGGGAATCACTTTCTTCGT | 0,989 | 0,99 |
The presented genes coded for proteins identified within the salivary gland proteome of D. vitifoliae larvae feeding on root galls of Teleki 5C. The gene accession IDs refer to the D. vitifoliae genome v 3.2 provided by the International Aphid Genomic Consortium (IAGC). ‘Dv 1–5’ refers to five conserved DvEffectors, whereas ‘Fp1-3’ to false positives functionally not associated to D. vitifoliae feeding. The gene annotation corresponds to the A. pisum effector ortholog.