KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Mouse strains | ||
| C57BL/6 | Charles River | N/A |
| Cx3cr1DTR mice | The Jackson Lab | Stock # 025629 |
| dLck-cre-recombinase mice | The Jackson Lab | Stock # 012837 |
| IL-21-tRFP reporter mice | (Shulman et al. 2014) | N/A |
| Flow Cytometry Reagents | ||
| Anti-mouse PD.1 (RMP1-30) | Biolegend | Cat #109110; RRID:AB_572017 |
| Anti-mouse Thy1.1 (OX-7) | Biolegend | Cat #202506; RRID:AB_492882 |
| Anti-mouse CXCR3 (CXCR3-173) | Biolegend | Cat #126512; RRID:AB_1088993 |
| Anti-mouse CXCR5 (L138D7) | Biolegend | Cat #145526; RRID:AB_2566799 |
| Anti-mouse CXCR6 (SA051D1) | Biolegend | Cat #151117; RRID:AB_2721700 |
| Anti-mouse CX3CR1 (SA011F11) | Biolegend | Cat #149014; RRID:AB_2565698 |
| Anti-mouse Ly108 (330-AJ) | Biolegend | Cat #134608; RRID:AB_2188093 |
| Anti-mouse Tim3 | BD Biosciences | Cat #747625; RRID:AB_2744191 |
| Anti-mouse 2B4 (M2B4 (B6)458.1) | Biolegend | Cat #133503; RRID:AB_1595624 |
| Anti-mouse KLRG1 (2F1) | Biolegend | Cat #138416; RRID:AB_2561736 |
| Anti-mouse KLRa9 (Ly-49I; YLI-90) | eBioscience | Cat #12-5895-82; RRID:AB_466021 |
| Anti-mouse CD127 (A7R34) | Biolegend | Cat #135014; RRID:AB_1937265 |
| Anti-mouse CD107a (1D4B) | Biolegend | Cat#121616; RRID:AB_10643268 |
| Anti-mouse TNF-α (MP6-XT22) | Biolegend | Cat#506306; RRID:AB_315427 |
| Anti-mouse IFNγ (XMG1.2) | Biolegend | Cat#505826; RRID:AB_2295770 |
| Anti-human/mouse Granzyme B (GB11) | Invitrogen | Cat#GRB04; RRID:AB_2536538 |
| Anti-TCF-1 (C63D9) | Cell Signaling | Cat#2203S; RRID:AB_2199302 |
| Anti-mouse BATF (D7C5) | Cell Signaling | Cat#8638S; RRID:AB_11141425 |
| Anti-mouse Eomes (Dan11mag) | Invitrogen | Cat#25-4875-82; RRID:AB_2573454 |
| Anti-mouse T-bet (4B10) | Biolegend | Cat#644806; RRID:AB_1595488 |
| LCMV DbGP33 tetramer | Made in house | N/A |
| Brefeldin A Solution (1,000X) | Biolegend | Cat#420601 |
| Fixation Buffer | Biolegend | Cat#420801 |
| True Nuclear Transcription Factor Buffer Set | Biolegend | Cat#424401 |
| Experimental Models: LCMV | ||
| LCMV Clone (Cl13) virus strain | Rafi Ahmed | Grew up in house |
| Experimental Models: Tumor Cell Lines | ||
| B16/F10 tumor cell line | ATCC | Cat# CRL-6475 |
| Chemicals, Peptides and Recombinant Proteins | ||
| RNAlater-ICE | Invitrogen | Cat#AM7030 |
| KAVYNFATM (GP33-41) peptide | GenScript | RP20257 |
| Oligonucleotides | ||
| GP-F: CATTCACCTGGACTTTGTCAGACTC | (McCausland and Crotty 2008) IDT |
N/A |
| GP-R: GCAACTGCTGTGTTCCCGAAAC | (McCausland and Crotty 2008) IDT |
N/A |
| Critical Commercial Assays | ||
| Incucyte Annexin V Red Reagent | Essen Bioscience | Cat#4641 |
| QiAmp MinElute Virus Spin Kit | Qiagen | Cat#57704 |
| RNAqueous-Micro Kit | Thermofisher | Cat#AM1931 |
| Mouse Treatment reagents | ||
| Anti-mouse CD4 Mab (GK1.5) | Bioxcell | Cat#BE0003-1 |
| Anti-PD-L1 (10F.9G2) | Bioxcell | Cat#BE0101 |
| Diptheria Toxin | Sigma-Aldrich | Cat#D0564 |
| Single cell RNA sequencing | ||
| Chromium Single Cell 3’ Library & Gel Bead Kit v2 | 10X Genomics | Cat#PN-120267 |
| Chromium Single Cell A Chip Kit | 10X Genomics | Cat#PN-1000009 |
| Chromium i7 Multiplex Kit | 10X Genomics | Cat# PN-120262 |
| Dynabeads™ MyOne™ Silane | Thermofisher | Cat#37002D |
| SPRIselect Reagent Kit | Beckman Coulter | Cat#B23318 |
| Kappa NGS quantification kit | KAPABiosystems | Cat#KK4824 |
| NextSeq 500/550 High Output Kit v2.5 (150 cycles) | Illumina | Cat#20024907 |
| Computational analysis | ||
| Cell Ranger | 10X Genomics | https://support.10xgenomics.com/single-cell-gene-expression/software/pipelines/latest/installation |
| Seurat | (Satija et al. 2015) | https://satijalab.org/seurat/ |
| Monocle-2 | (Qiu et al. 2017) (Trapnell et al. 2014) |
http://cole-trapnell-lab.github.io/monocle-release/docs/ |
| Datasets | ||
| Day 8 and Day 30 single cell RNA sequencing on DbGP33+ CD8 T cells | In this paper | GSE 129139 |
| Statistical or Data Analysis | ||
| Flowjo Version 10.5.3 | Tree Star | N/A |
| Prism 8 | Graphpad Software | N/A |