| Antibodies |
| Anti-B220-V500 (Clone RA3–6B2) |
BD Pharmigen |
Cat# 561227; RRID:AB_10562193 |
| Anti-Cxcr5-PE-eFluor 610 (Clone SPRCL5) |
Thermofisher |
Cat# 61–7185–82; RRID:AB_2574660 |
| Anti-CD4-BUV737 |
BD Pharmigen |
Cat# 564298, RRID:AB_2732918 |
| Anti-TCRb-BV711 |
BD Pharmigen |
Cat# 563135; RRID:AB_2629564 |
| Anti-Thy1.1-FITC |
Thermofisher |
Cat# 11–0900–81; RRID:AB_465151 |
| Anti-CD44-AF700 |
Thermofisher |
Cat# 56–0441–82; RRID:AB_494011 |
| Anti-PD-1-PECy7 |
Thermofisher |
Cat# 25–9985–82; RRID:AB_10853805 |
| Anti-CD8b-BUV395 |
BD Pharmigen |
Cat# 563786; RRID:AB_2732919 |
| Anti-CD45.2- BV786 |
BD Pharmigen |
Cat# 563686; RRID:AB_2738375 |
| Siglec F-BV510 |
BD Pharmigen |
Cat# 740158; RRID:AB_2739911 |
| NK1.1-BV510 |
BD Pharmigen |
Cat# 563096; RRID:AB_2738002 |
| CD11b-BV510 |
BD Pharmigen |
Cat# 562950; RRID:AB_2737913 |
| CD11c-BV510 |
BD Pharmigen |
Cat# 562949; RRID:AB_2732056) |
| IL7R-APC |
Thermofisher |
Cat# 17–1271–82; RRID:AB_469435 |
| Ccr7-PE |
Thermofisher |
Cat# 12–1979–42; RRID:AB_10670625 |
| Ccr7-PE-Cy7 |
Thermofisher |
Cat# 25–1971–82; RRID:AB_469652 |
| Bcl6-BV421 |
BD Pharmigen |
Cat# 563363; RRID:AB_2738159 |
| Lag3-APC-ef780 |
Thermofisher |
Cat# 47–2231–82; RRID:AB_2637323 |
| Foxp3-ef450 |
Thermofisher |
Cat# 48–5773–82; RRID:AB_1518812 |
| Foxp3-AF488 |
Thermofisher |
Cat# 53–5773–82; RRID:AB_763537 |
| Granzyme B-PE |
Innovative Research |
Cat# MHGB04; RRID:AB_10372671 |
| Tbet-PE-Cy7 |
Thermofisher |
Cat# 25–5825–82; RRID:AB_11042699 |
| CD200-APC-R700 |
BD Pharmigen |
Cat# 565546; RRID:AB_2739288 |
| CD39-super bright 600 |
Thermofisher |
Cat# 63–0391–82; RRID:AB_2717037 |
| IRF7-PE |
Thermofisher |
Cat# 12–5829–82; RRID:AB_2572629 |
| CD278-BV421 |
BioLegend |
Cat# 313523; RRID:AB_2562538 |
| PD-1-PE-Cy7 |
Thermofisher |
Cat# 25–9985–82; RRID:AB_10853805 |
| PD-1-BU395 |
BD Pharmigen |
Cat# 744549; RRID:AB_2742320 |
| TIM3-PE |
BioLegend |
Cat# 119704; RRID:AB_345378 |
| CD94-FITC |
Thermofisher |
Cat# 11–0941–82; RRID:AB_465161 |
| NKG2A/NKG2C/NKG2E-Percp-ef710 |
Thermofisher |
Cat# 46–5896–82; RRID:AB_10853352 |
| IFNγ-FITC |
BioLegend |
Cat# 505806; RRID:AB_315400 |
| Bacterial and Virus Strains |
| LCMV Armstrong |
McGavern Lab |
|
| LCMV Clone 13 |
McGavern Lab |
|
| Biological Samples |
| MC38 tumor samples |
This paper |
|
| MC38-GP tumor samples |
This paper |
|
| Chemicals, Peptides, and Recombinant Proteins |
| I-Ab LCMV GP66–77 (DIYKGVYQKSV) tetramer-PE |
NIH tetramer facility |
|
| H-2Db LCMV GP33–42 (KAVYNFATM) tetramer- APC |
NIH tetramer facility |
|
| PMA |
Sigma-Aldrich |
Cat# P8139 |
| Ionomycin |
Sigma-Aldrich |
Cat# I 0634–1mg |
| DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) |
Life Technologies |
Cat# D1306 |
| Protein Transport Inhibitor |
BD Pharmigen |
Cat# 554724 |
| I-Ab
Toxoplasma gondii AS15 (KAVYNFATM) tetramer-ef450 |
NIH tetramer facility |
|
| Critical Commercial Assays |
| eBioscience Transcription Staining Buffer Set |
Invitrogen |
Cat# 00–5523–00 |
| Fixable Viability Dye UV |
Invitrogen |
Cat# 65–0868–18 |
| Deposited Data |
| scRNaseq: single cell expression profiles of CD4+ T cells |
This paper |
GSE124691 |
| scRNaseq of Human liver cancer TILs |
Zheng et al., 2017a |
GSE98638 |
| scRNaseq of Human melanoma TILs |
Sade-Feldman et al., 2018 |
GSE120575 |
| Experimental Models: Cell Lines |
| MC38-GP murine colon cancer cell lines |
This paper |
|
| MC38 murine colon cancer cell lines |
Jack Greiner’s lab |
|
| Experimental Models: Organisms/Strains |
| C57BL/6Ncr (CD45.2) |
Charles River |
Charles River 556 |
| Oligonucleotides |
|
LCMV-GP-F: 5′ GGATCC ATGGGTCAGATTGTGACAATGTTTG 3′ |
This paper |
|
|
LCMV-GP-R: 5′ GCGGCCGCTCAGCGTCTTTTCCAGACGGTTTTTAC 3′ |
This paper |
|
| Recombinant DNA |
| pMRX |
Saitoh, 2002 |
|
| pHCMV-LCMV-Arm53b |
Sena-Esteves, 2004 |
Addgene 15796 |
| Software and Algorithms |
| RobustSingleCell |
This paper |
https://github.com/asmagen/RobustSingleCell |
| Flowjo 10.0 |
Flowjo |
https://www.flowjo.com |
| 10X Genomics Cellranger toolkit v2.0.1 |
10X Genomics |
http://software.10xgenomics.com/single-cell/overview/welcome |
| Prism 7 |
Graphpad |
https://www.graphpad.com/scientific-software/prism/ |
| R |
R |
https://www.r-project.org |
| Seurat cell alignment v2.0.1 |
Butler et al., 2018 |
https://satijalab.org/seurat/immune_alignment.html |
