KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| chicken anti-EGFP | Abcam | Cat# ab13970, RRID:AB_300798 |
| goat anti-V5 | Abcam | Cat# ab95038, RRID:AB_10676056 |
| rabbit anti-Sox9 | Abcam | Cat# ab185230, RRID:AB_2715497 |
| rabbit anti-ALDH1L1 | Abcam | Cat# ab56149, RRID:AB_879534 |
| human anti-C-Myc Epitope Tag | Absolute Antibody | Cat# Ab00100–10.0 |
| rabbit anti-H3.3S31ph | Active Motif | Cat# 39637 |
| chicken anti-C-Myc Epitope Tag | Aves | Cat# ET-MY100, RRID:AB_2313514 |
| rat anti-CD44 | BD Biosciences | Cat# 550538, RRID:AB_39373 |
| rat anti-PDGFRα | BD Pharmingen | Cat# 558774, RRID:AB_397117 |
| mouse anti-Foxj1 | Invitrogen | Cat# # 14-9965-82 RRID: AB_1548835 |
| rabbit anti-AU1 Epitope Tag | Biolegend | Cat# 903101, RRID:AB_256502 |
| sheep anti-p53 | Calbiochem | Cat# PC35, RRID: AB_2240806 |
| rabbit anti-H3K27Me3 | Cell Signaling | Cat# 9733, RRID:AB_2616029 |
| sheep anti-V5 | LSBio | Cat# LS-C136566, RRID: AB_10915392 |
| rat anti-GFAP | Invitrogen | Cat# 13-0300, RRID: AB_2532994 |
| rabbit anti-HA | Cell Signaling | Cat# 3724, RRID:AB_1549585 |
| rabbit anti-pRB 1 | Cell Signaling | Cat# 8516S, RRID:AB_11178658 |
| rabbit anti-Sox2 | Cell Signaling | Cat# 3579, RRID:AB_2195767 |
| rabbit anti-Bmi1 | Cell Signaling | Cat# 6964P, RRID:AB_10839408 |
| rabbit anti-H3K27Ac | Cell Signaling | Cat# 8173P, RRID:AB_10949887 |
| mouse anti-TetR | Clontech | Cat# 631132 |
| rabbit anti-Dsred | Clontech | Cat# 632496, RRID:AB_10013483 |
| mouse anti-V5 | Invitrogen | Cat# R960-25, RRID:AB_2556564 |
| rabbit anti-mCherry | Kerafast | Cat# EMU-106 |
| guinea pig anti-mKate2 | Kerafast | Cat# EMU108 |
| rat anti-Tdtomato | Kerafast | Cat# EST203, RRID:AB_2732803 |
| rabbit anti-H3F3A | Lifespan Biosciences | Cat# LS-C148509-100, RRID:AB_11135921 |
| rabbit anti-H3F3A K27M | Millipore | Cat# ABE419, RRID:AB_2728728 |
| rabbit anti-NG2 | Millipore | Cat# AB5320, RRID:AB_11213678 |
| sheep anti-Dll1 | R&D Systems | Cat# AF5026, RRID:AB_2092830 |
| goat anti-Olig2 | R&D Systems | Cat# AF2418, RRID:AB_2157554 |
| rabbit anti-H3.3G34R | Revmab | Cat# 31-1120-00, RRID:AB_2716433 |
| rabbit anti-Atrx | Sigma | Cat# HPA001906, RRID:AB_1078249 |
| mouse anti-Flag | Sigma Aldrich | Cat# F1804, RRID:AB_262044 |
| guinea pig anti-GFAP | Synaptic Systems | Cat# 173 004, RRID:AB_10641162 |
| Bacterial and Virus Strains | ||
| One Shot MAX Efficiency DH5-T1R cells | Invitrogen | Cat# 12297016 |
| Stellar chemically competent cells for cloning | Clontech | Cat# 636766 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Tris-EDTA buffer | Sigma-Aldrich | Cat# E8008-100ML |
| Fast Green Dye | Sigma Aldrich | Cat# F7258-25g |
| SignaGel Electrode Gel | Medline Industries | Cat# PLI1525CSZ |
| Low-Melting Point Agarose | Fisher Bioreagents | Cat# bp1360-100 |
| Human Epidermal Growth Factor | Sigma-Aldrich | Cat# E9644 |
| Heparin | Sigma-Aldrich | Cat# H3393 |
| Basic Fibroblast Growth Factor (bFGF) | Millipore | Cat# GF003 |
| Doxycycline | Clontech | Cat# 631311 |
| Puromycin | Clontech | Cat# 631305 |
| Methanol | Sigma Aldrich | Cat# 179337 |
| Hydrogen peroxide solution | Sigma Aldrich | Cat# H1009 |
| Triton X-100 | Sigma Aldrich | Cat# X-100-500ML |
| Dimethyl sulfoxide (DMSO) | Sigma Aldrich | Cat# D2650-5X10ML |
| Glycine | Sigma Aldrich | Cat# 410225-50g |
| Normal Donkey Serum | Jackson ImmunoResearch | Cat# 017-000-121 |
| Dichloromethane | Sigma Aldrich | Cat# 270997 |
| Dibenzyl Ether | Sigma Aldrich | Cat# 108014 |
| Acryloyl-X, SE, 6-((acryloyl)amino)hexanoic Acid, Succinimidyl Ester | Thermo-Fisher | Cat# A20770 |
| NaCl | Sigma-Aldrich | Cat# S9888 |
| Sodium Acrylate | Sigma-Aldrich | Cat# 408220 |
| Tetramethylethylenediamine | Sigma-Aldrich | Cat# T9281 |
| Ammonium Persulfate | Sigma-Aldrich | Cat# A3678-25g |
| 4-hydroxy-2,2,6,6-tetramethylpiperidin-1-oxyl | EMD Millipore | Cat# 840130 |
| Proteinase K | New England Biolabs | Cat# P8107S |
| Draq5 | Cell Signaling | Cat# 4084S |
| Eosin Y | Sigma-Aldrich | Cat# E4009 |
| Collagenase IV | Worthington Biochemical | Cat# LS004189 |
| DNAse I | Worthington Biochemical | Cat# LS002007 |
| ACK Lysis Buffer | Thermo Fisher Scientific | Cat# A1049201 |
| Neurobasal media | Thermo Fisher Scientific | Cat# 21103049 |
| DMEM, High Glucose | Thermo Fisher Scientific | Cat# 11965118 |
| Penicillin-Streptomycin-Amphotericin | Thermo Fisher Scientific | Cat# 15240096 |
| B-27 supplement without Vitamin A | Thermo Fisher Scientific | Cat# A3353501 |
| Glutamax | Thermo Fisher Scientific | Cat# 35050061 |
| Human EGF | Shenandoah Biotechnology | Cat# 100-26-500ug |
| Human FGF (Shenandoah Biotechnology, Warwick, PA), | Shenandoah Biotechnology | Cat# 100-146-100ug |
| PDGF-AA (Shenandoah Biotechnology, Warwick, PA) | Shenandoah Biotechnology | Cat# 100-16-100ug |
| Heparin Solution 0.2% | StemCell Technologies | Cat# 07980 |
| CELLstart | Thermo Fisher Scientific | Cat# A10142-01 |
| Akalumine-HCL | Sigma Aldrich | Cat# 808350 |
| Vacquinol-1 | Sigma-Aldrich | Cat# SML1187 |
| AKT 1/2 kinase inhibitor | Sigma-Aldrich | Cat# A6730 |
| Tween20 | Bio-Rad | Cat# 1610781 |
| Digitonin | Sigma-Aldrich | Cat# 300410 |
| Nonidet P40 substitute | Sigma-Aldrich | Cat# 74385 |
| Critical Commercial Assays | ||
| DNeasy | Qiagen | Cat# 69504 |
| Zero Blunt TOPO kit | Thermo Fisher | Cat# 450159 |
| Chromium™ Single Cell 3’ Library & Gel Bead Kit v2 | 10X Genomics | Cat# 120237 |
| SPRIselect Reagent Kit | Beckman Coulter | Cat# B23318 |
| Chromium Single-Cell 3’ Library Kit | 10X Genomics | Cat# PN-120237 |
| KAPA Library Quantification Kit | Roche | Cat# 07960140001 |
| KAPA HiFi PCR kit | Kapabiosystems | Cat# KR0368 |
| In-Fusion cloning | Clontech | Cat# 638920 |
| NEBuilder HiFi DNA Assembly Master Mix | New England Biolabs | Cat# E2621L |
| Deposited Data | ||
| Mice raw and analyzed data | This paper | GEO: GSE117154, GSE131675, GSE131672 |
| Human data | GEO website | GEO: GSE70630, GSE89567, GSE102130 |
| P50 and E18 mouse scATAC data | 10X Genomics | https://www.10xgenomics.com/resources/datasets/ |
| Experimental Models: Cell Lines | ||
| Mouse MADR cell line: K27M-1 | This paper | N/A |
| Mouse MADR cell line: K27M-2 | This paper | N/A |
| Mouse MADR cell line: K27M-3 | This paper | N/A |
| Mouse mTmG cell line: TdTomato+ | This paper | N/A |
| Human: HEK293T | ATCC | Cat# CRL-3216 |
| Mouse: Neuro-2a | ATCC | Cat# CCL-131 |
| Experimental Models: Organisms/Strains | ||
| Mouse: CD1 | Charles River Laboratories | Strain Code 022 |
| Mouse: C57BL/6J | The Jackson Laboratory | JAX: 000664 |
| Mouse: Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo/J | The Jackson Laboratory | JAX: 007676 |
| Mouse: Gt(ROSA)26Sortm1.1 (CAG-EGFP)Fsh/Mmjax | The Jackson Laboratory | JAX: 32037 |
| Oligonucleotides | ||
| sgRNA targeting sequence: Pten: gcCTCAGCCATTGCCTGTGTG | This paper | N/A |
| sgRNA targeting sequence: Trp53: GCCTCGAGCTCCCTCTGAGCC | This paper | N/A |
| sgRNA targeting sequence: Nf1: GCAGATGAGCCGCCACATCGA | This paper | N/A |
| sgRNA targeting sequence (BE): Pten: CCTcAGCCATTGCCTGTGTG | This paper | N/A |
| sgRNA targeting sequence (BE): Trp53: CTGAGCcAGGAGACATTTTC | This paper | N/A |
| sgRNA targeting sequence (BE): Nf1: TCCTcAGTCACACATGCCAG | This paper | N/A |
| Recombinant DNA | ||
| plasmid: MADR pDonor-TagBFP2-3XFlag (cyto) WPRE | This paper | Addgene Plasmid #129421 |
| plasmid: pCag TagBFP2-V5 Cyto PB | This paper | N/A |
| plasmid: MADR pDonor rtTA-V10-AU1-P2a-puro-WPRE TRE-smFP-HA | This paper | N/A |
| plasmid: MADR pDonor rtTA-V10-AU1-P2a-puro-WPRE TRE-smFP-Myc | This paper | N/A |
| plasmid: MADR pDonor rtTA-V10-AU1-P2a-puro-WPRE TRE-smFP-Flag | This paper | N/A |
| plasmid: MADR pDonor rtTA-V10-AU1-P2a-puro-WPRE TRE-SM TagBFP-V5 (weakly-fluorescent) | This paper | N/A |
| plasmid: pCag-FlpO-2A-Cre | This paper | Addgene Plasmid #129419 |
| plasmid: pCag-SE-FlpE-2A-Cre | This paper | Addgene Plasmid #130986 |
| plasmid: CMV FlpO-2a-Cre | This paper | N/A |
| plasmid: pAAV-Ef1a-flpo-2a-cre-wpre | This paper | N/A |
| plasmid: MADR pAAV-(inverted; promoterless) TagBFP2-3Flag cyto-wpre | This paper | N/A |
| plasmid: CMV Flp-Ires-Cre | This paper | N/A |
| plasmid: AAVS1_Tagbfp2-V5-nls-P2A-Puro_Cag LoxP myrTdtomato FRT | This paper | N/A |
| plasmid: MADR pDonor-smFP-myc (bright) WPRE | This paper | N/A |
| plasmid: MADR pDonor-smFP-Flag (bright) WPRE | This paper | N/A |
| plasmid: MADR pDonor-smFP-V5 (dark) WPRE | This paper | Addgene Plasmid #131006 |
| plasmid: MADR pDonor-smFP-Myc (dark) WPRE | This paper | Addgene Plasmid #130987 |
| plasmid: MADR pDonor-smFP-HA (dark) WPRE | This paper | Addgene Plasmid #131007 |
| plasmid: MADR pDonor-smFP-Flag (dark) WPRE | This paper | Addgene Plasmid #131005 |
| plasmid: MADR pDonor-mScarlet-3XSpot WPRE | This paper | N/A |
| plasmid: MADR pDonor-SM_TagBFP2-V5 (weakly-fluorescent) WPRE | This paper | N/A |
| plasmid: MADR pDonor-SM TagBFP2-V5-(cyto)-2A-Vcre WPRE | This paper | N/A |
| plasmid: pCag FlEx Vlox smFP-myc (dark) WPRE | This paper | N/A |
| plasmid: pCag TagBFP2-V5 Cypo PB triple miR-E shNf1.789:shTrp53.8914:shPten.1524 WPRE |
This paper | N/A |
| plasmid: MADR pDonor-SM-TagBFP2-V5-P2A-SpCas9 WPRE | This paper | N/A |
| plasmid: MADR pDonor-smFP-mycBRIGHT-pTV1_FNLS-Cas9-BW WPRE | This paper | N/A |
| pC0043-SpCas9 BbsI (Empty) crRNA backbone (episomal) | This paper | N/A |
| pC0043-SpCas9 sg.Trp53 (episomal; for use with FNLS base editor) | This paper | N/A |
| pC0043-SpCas9 sg.Nf1 (episomal; for use with FNLS base editor) | This paper | N/A |
| pC0043-SpCas9 sg.Pten (episomal; for use with FNLS base editor) | This paper | N/A |
| plasmid: MADR pDonor-smFP-myc-P2A-EspCas9 WPRE | This paper | N/A |
| plasmid: MADR pDonor-smFP-myc-P2A-Cas13b WPRE | This paper | N/A |
| plasmid: MADR pDonor-smFP-myc-P2A-CasRX WPRE | This paper | N/A |
| pU6 BsmBi Empty SpCas9-crRNA Cag miRFP670-3X-HA WPRE PB | This paper | N/A |
| pU6 BsmBi Empty CasRX-crRNA Cag miRFP670-3X-HA WPRE PB | This paper | N/A |
| pU6 BsmBi Empty Cas13b-crRNA Cag miRFP670-3X-HA WPRE PB | This paper | N/A |
| plasmid: MADR pDonorRCE TagBFP2-Hras G12V Wpre (RCE donor compatible) | This paper | N/A |
| plasmid: MADR pDonor TagBFP2-Hras G12V Wpre (mtmg donor compatible) | This paper | Addgene Plasmid #129420 |
| plasmid: Ubi-EGFP-HRasG12V PB | Breunig et al. Cell Reports, 2015 | 10.1016/j.celrep.2015.06.012 |
| plasmid: MADR pDonor-smFP_Myc_p2a_YAP1-MAMl1D | This paper | N/A |
| plasmid: MADR pDonor-smFP_Myc_p2a_c11orf95-RELA | This paper | N/A |
| plasmid: MADR pDonor smFP_Myc_p2a_Kras G12A | This paper | N/A |
| plasmid: MADR pDonor-H3F3A-K27M-EGFP pTV1 Pdgfra D842V COTv1 Trp53-V5 WPRE | This paper | N/A |
| plasmid: MADR pDonor-H3F3A-G34R-EGFP pTV1 Pdgfra D842V COTv1 Trp53-V5 WPRE | This paper | N/A |
| plasmid: MADR pDonor-H3F3A-WT-EGFP pTV1 Pdgfra D842V COTv1 Trp53-V5 WPRE | This paper | N/A |
| plasmid: MADR pDonor-smFP-mycBRIGHT-pTV1 Pdgfra D842V COTv1 Trp53 270h-P2ACO3-H3F3A K27M WPRE | This paper | N/A |
| plasmid: MADR pDonor-smFP-mycBRIGHT-pTV1 Pdgfra D842V COTv1 Trp53 270h-P2ACO3-H3F3A G34R WPRE | This paper | N/A |
| plasmid: MADR pDonor-smFP-mycBRIGHT-pTV1 Pdgfra D842V COTv1 Trp53 270h-P2ACO3-H3F3A WT WPRE | This paper | N/A |
| plasmid: MADR pDonor-smFP-mycBRIGHT-pTV1 Pdgfra D842V COTv1 Trp53 270h-P2ACO3-H3F3A K27M WPRE::Ef1a-Akaluc(Inverted) | This paper | N/A |
| plasmid: MADR pDonor-PIP-NLS-Venus-P2A-mCherry-hGEM1/110 | This paper | N/A |
| plasmid: MADR pDonor-PIP-NLS-Venus-P2A-mIRFP670-hGEM1/110 | This paper | N/A |
| plasmid: MADR pDonor-PIP-NLS-mIRFP709-P2A-mIRFP670-hGEM1/110 (NIR-FUCCI) | This paper | N/A |
| plasmid: MADR pDonor-smFP-mycBRIGHT- pTV1 Pdgfra D842V COTv1 Trp53 270h-P2ACO3-H3F3A K27M WPRE ::Ef1a-NIR-FUCCI (Inverted) | This paper | N/A |
| plasmid: MADR pDonor-smFP-mycBRIGHT- pTV1 Pdgfra D842V COTv1 Trp53 270h-P2ACO3-H3F3A K27M WPRE::Ef1a-NIR-FUCCI* (*-hGEM C-term NLS mutant; Inverted) | This paper | N/A |
| plasmid: MADR pDonor rtTA-V10-AU1-P2a-puro-WPRE | This paper | N/A |
| plasmid: MADR pDonor rtTA-V10-AU1-P2a-puro-WPRE TRE-EGFP | This paper | N/A |
| plasmid: MADR pDonor rtTA-V10-AU1-P2a-puro-WPRE TRE-EGFP/mDll1 | This paper | N/A |
| Plasmid: pX330-dual U6-p16-p19-cdkn2a-Chimeric_BB-CBh-eSpCas9(1.1) | This paper | N/A |
| plasmid: pX330-U6-sg.ATRX-Chimeric_BB-CBh-eSpCas9(1.1) | This paper | N/A |
| plasmid: pX330-U6-sg.AAVS1-Chimeric_BB-CBh-eSpCas9(1.1) | This paper | N/A |
| plasmid: AAVS1-TALENs | Gift: Conklin and Mandegar (Mandegar et al., 2016) | N/A |
| plasmid: T7 FlpO-2A-Cre (mRNA generation) | This paper | N/A |
| plasmid: MC-FlpO-2A-Cre (parental) | This paper | N/A |
| minicircle: MC-FlpO-2A-Cre | This paper | N/A |
| plasmid: CMV Flp-2A-Cre | Gift: Y. Voziyanov (Anderson et al., 2012) | N/A |
| plasmid: mT/mG | (Muzumdar et al., 2007) | Addgene Plasmid #17787 |
| plasmid: CAG LF mTFP1 | Gift: I. Imayoshi (Imayoshi et al., 2012) | N/A |
| Software and Algorithms | ||
| Nikon’s Confocal NIS-Elements Package | Nikon | https://www.microscope.healthcare.nikon.com/products/software |
| Imaris 9.1 | Bitplane | https://imaris.oxinst.com/ |
| ImageJ software | NIH | https://imagej.nih.gov/ij/ |
| Syglass VR | IstoVisio | https://www.syglass.io/ |
| STAR/STARlong (version 2.5.1) | Dobin A et al. 2012 | https://github.com/alexdobin/STAR |
| Cell Ranger software version 2.0.0 (scRNA-seq) and 3.0.2 (snATAC-seq) | 10X Genomic | https://support.10xgenomics.com/single-cell-gene-expression/software/downloads/ |
| Seurat | Butler et al. 2018 | https://satijalab.org/seurat/ |
| Scanpy | Wolf FA et al. 2017 | https://scanpy.readthedocs.io/en/latest/ |
| SCENIC (1.0.0-02) | Aibar S et al. 2017 | https://github.com/aertslab/SCENIC |
| cisTOPIC | Bravo et al. 2019 | https://github.com/aertslab/cisTopic |
| SnapATAC | Fang et al. 2019 | https://github.com/r3fang/SnapATAC |
| Harmony | Korsunsky et al. 2019 | https://github.com/immunogenomics/harmony |
| ngs.plot v2.61 | Shen et al. 2014 | https://github.com/shenlab-sinai/ngsplot |
| IGV v.2.5.0 | Robinson et al. 2011 | https://software.broadinstitute.org/software/igv |
| bwa-mem | Li, H et al. 2009 | https://github.com/lh3/bwa |
| Other | ||