Table 1.
Information about the eight candidate reference genes and primer sequences used for quantitative real-time PCR (qPCR) in this study.
| Gene symbol | Gene description | Gene ID | Primer sequences (5′-3′)* | Amplicon length (bp) | Tm (°C) | PCR efficiency (%) | Correlation coefficient (R2) |
|---|---|---|---|---|---|---|---|
| 18S | 18S rRNA | AF206870.1 | tgacggagaattagggttcga/ccgtgtcaggattgggtaatt | 100 | 60 | 99 | 0.9743 |
| ACT | Actin1 | DQ665832.2 | gttgaaccctaaggctaacagag/ggaatccagcacgataccag | 139 | 60 | 100 | 0.9944 |
| GAPDH | glyceraldehyde-3- phosphate dehydrogenase | comp37700_c0 | tggagacaagaaacagcaccct/cggcaattccgccatttaac | 121 | 60 | 100 | 0.9635 |
| EF-1α | Elongation factor 1α | comp36076_c0 | tggccgtccttggaaatacc/ctcctgggcatcgtgacttt | 121 | 60 | 99 | 0.9578 |
| αTUB | α-tubulin | comp24081_c0 | tgcatttcggtccacatcg/catcatcacctccgccaac | 132 | 60 | 100 | 0.9222 |
| CYP2 | Cyclophilin2 | comp26478_c0 | cggcgagtctatctacgga/tgacgatttccattccctcg | 200 | 60 | 100 | 0.9626 |
| UBQ | Ubiquitin | comp20072_c0 | agacgagcataacatttcctgc/gccgtactcttgccgattac | 151 | 60 | 100 | 0.9273 |
| F-box | F-box family protein | comp30228_c0 | atagagggcgtaggctgagg/tccttcgggtggttatgttc | 127 | 60 | 98 | 0.9889 |
*The primer sequences represent forward/reverse primers for each gene.