Table 1.
Oligonucleotide primer sequences used for amplification of 16S rRNA universal, uspA, uidA, and ntrA genes and PCR cycling conditions used.
| Primers | Sequence (5′–3′) | Targeted gene | Amplicon size (bp) | PCR conditions and cycles | Reference |
|---|---|---|---|---|---|
| 27F | AGAGTTTGATCATGGCTCAG | 16S rRNA | 1420 | 1 cycle of 3 minutes at 94°C, 25 cycles of 1 minute at 94°C, 1 minute at 55°C, 2 minutes at 72°C; 1 cycle of 10 minutes at 72°C | [21] |
| 1492R | GGTACCTTGTTACGACTT | ||||
| uspAF | CCGATACGCTGCCAATCAGT | uspA | 884 | 1 cycle of 5 minutes at 95°C, 30 cycles of 30 seconds at 94°C, 30 seconds at 56°C, 30 seconds at 72°C; 1 cycle of 5 minutes at 72°C | [22] |
| uspAR | ACGCAGACCGTAGGCCAGAT | ||||
| uidAF | CTGGTATCAGCGCGAAGTCT | uidA | 556 | 1 cycle of 10 minutes at 95°C, 35 cycles of 45 seconds at 95°C, 30 seconds at 59°C, 1 minute 30 seconds at 72°C; 1 cycle of 10 minutes at 72°C | [23] |
| uidAR | AGCGGGTAGATATCACACTC | ||||
| ntrA | CATCTCGATCTGCTGGCCAA | ntrA | 90 | 1 cycle of 10 minutes at 95°C, 35 cycles of 45 seconds at 95°C, 30 seconds at 55°C, 1 minute 30 seconds at 72°C; 1 cycle of 10 minutes at 72°C | |
| ntrA | GCGCGGATCCAGCGATTGGA |