KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Chemicals, Peptides, and Recombinant Proteins | ||
| Tris Salt of Phosphocreatine | Millipore Sigma | Cat# P1937 CAS# 108321-17-1 |
| Tris Salt of ATP | Millipore Sigma | Cat# A9062 CAS# 102047-34-7 |
| MOPS Free Acid | Millipore Sigma | Cat# M1254 CAS# 1132-61-2 |
| MES Potassium Salt | Millipore Sigma | Cat# M0895 CAS# 39946-25-3 |
| Bovine Serum Albumin (Fatty Acid Free) | Millipore Sigma | Cat# A3803 CAS# 9048-46-6 |
| Potassium Pyruvate | Combi-Blocks | Cat# QA-1116 CAS# 4151-33-1 |
| Potassium NADP+ | Ark-Pharm, Inc | Cat# AK671068 |
| Creatine Kinase from Rabbit Muscle | Millipore Sigma | Cat# 10736988001 |
| Amplex Ultra Red Reagent (AUR) | ThermoFisher | Cat# A36006 |
| CelLytic M | Millipore Sigma | Cat# C2978 |
| Tetramethylrhodamine Methyl Ester (TMRM) | ThermoFisher | Cat# T668 |
| Phosphoenoyl-pyruvate | Millipore Sigma | Cat# 10108294001 CAS# 4265-07-0 |
| Auranofin |
Millipore Sigma | Cat# A6733 |
| Rotenone | Millipore Sigma | Cat# R8875 CAS# 83-79-4 |
| Potassium Cyanide | Millipore Sigma | Cat# 60178 CAS# 151-50-8 |
| Peroxidase from Horseradish (HRP) | Millipore Sigma | Cat# P8375 CAS# 9003-99-0 |
| Superoxide Dismutase (SOD) | Millipore Sigma | Cat# S9697 CAS# 9054-89-1 |
| Glucose-6-phosphate Dehydrogenase (G6PDH) | Millipore Sigma | Cat# G6378 CAS# 9001-40-5 |
| Malate Dehydrogenase (MDH) | Millipore Sigma | Cat# 442610-M CAS# 9001-64-3 |
| Pyruvate Kinase/Lactic Dehydrogenase Enzymes from Rabbit Muscle | Millipore Sigma | Cat# P0294 |
| Hexokinase | Millipore Sigma | Cat# H4502 CAS# 9002-07-7 |
| Trypsin from Porcine Pancreas (Trypsin) | Millipore Sigma | Cat# T4799 CAS# 9001-51-8 |
| Creatine Monohydrate | Millipore Sigma | Cat# C3630 CAS# 6020-87-7 |
| Palmitoyl-L-carnitine | Millipore Sigma | Cat# P1645 CAS# 18877-64-0 |
| Octanoyl-L-carnitine | Millipore Sigma | Cat# 50892 CAS# 25243-95-2 |
| Malic Acid (Malate) | Millipore Sigma | Cat# M1000 CAS# 97-67-6 |
| Glutamic Acid (Glutamate) | Millipore Sigma | Cat# G1501 CAS# 6382-01-0 |
| Succinic Acid (Succinate) | Millipore Sigma | Cat# S3674 CAS# 110-15-6 |
| α-ketoglutaric Acid (AKG) | Millipore Sigma | Cat# K1750 CAS# 328-50-7 |
| Isocitrate | Millipore Sigma | Cat# 58790 CAS# 20226-99-7 |
| Adenosine Diphosphate (ADP) | Millipore Sigma | Cat# A5285 CAS# 72696-48-1 |
| NADH | Millipore Sigma | Cat# N4505 CAS# 104809-32-7 |
| Nicotinamide Adenine Dinucleotide (NAD+) | Millipore Sigma | Cat# N1636 CAS# 53-84-9 |
| L-Aspartic Acid (Aspartate) | Millipore Sigma | Cat# A9256 CAS# 56-84-8 |
| Acetoacetyl-CoA | Millipore Sigma | Cat# A1625 CAS# 1420-36-6 |
| Coenzyme A | Millipore Sigma | Cat# C3019 CAS# 18439-24-2 |
| Acetyl-CoA | Millipore Sigma | Cat# 10101907001 CAS# 32140-51-5 |
| Potassium Chloride | Millipore Sigma | Cat# P5405 CAS# 7447-40-7 |
| Sodium Chloride | Millipore Sigma | Cat# S7653 CAS# 7647-14-5 |
| EDTA | Millipore Sigma | Cat# E0270 CAS# 65501-24-8 |
| EGTA | Millipore Sigma | Cat# E4378 CAS# 67-42-5 |
| Alamethicin | Enzo Life Sciences | Cat# BML-A150-0025 |
| L-Carnitine HCl | Millipore Sigma | Cat# C0283 CAS# 6645-46-1 |
| CDNB | Millipore Sigma | Cat# 237329 CAS# 97-00-7 |
| Nicotinamide | Millipore Sigma | Cat# N3376 CAS# 98-92-0 |
| Antimycin A | Millipore Sigma | Cat# A8674 CAS# 1397-94-0 |
| Oligomycin | Millipore Sigma | Cat# 75351 CAS# 579-13-5 |
| Magnesium Green 5K+ salt | ThermoFisher Scientific | Cat# M3733 CAS# 170516-41-3 |
| Lactobionic Acid | Millipore Sigma | Cat# 153516 CAS# 96-82-2 |
| Glycerol | Millipore Sigma | Cat# G9012 CAS# 56-81-5 |
| Magnesium Chloride Hexahydrate | Millipore Sigma | Cat# M2670 CAS# 7791-18-6 |
| Potassium Dihydrogen Phosphate | Millipore Sigma | Cat# P9791 CAS# 7778-77-0 |
| HEPES | Millipore Sigma | Cat# H3375 CAS# 7365-45-9 |
| AP5A | Millipore Sigma | Cat# D4022 CAS# 4097-04-5 |
| Decylubiquinone | Enzo Life Sciences International | Cat# BML-CM115-0050 |
| D-Glucose (U-13C6, 99%) | Cambridge Isotope Laboratories, Inc | Cat# CLM-1396 CAS#110187-42-3 |
| MOX | Millipore Sigma | Cat# 226904 CAS# 593-56-6 |
| MTBSTFA with 1%TBDMCS | Millipore Sigma | Cat# M-108 CAS# 77377-52-7 |
| Chloroform | Millipore Sigma | Cat# C2432 CAS# 67-66-3 |
| Methanol | Millipore Sigma | Cat# 439193 CAS# 67-56-1 |
| Protease Inhibitor Cocktail | Millipore Sigma | Cat# P8340 |
| Pierce BCA Protein Assay Kit | ThermoFisher Scientific | Cat#23225 |
| Phosphatase Inhibitor Cocktail 2 | Millipore Sigma | Cat# P5726 |
| Phosphatase Inhibitor Cocktail 3 | Millipore Sigma | Cat# P0044 |
| Pierce Reversible Protein Stain Kit for Nitrocellulose Membranes | ThermoFisher Scientific | Cat# 24580 |
| 4–15% Criterion TGX Stain-Free Protein Gel, 18well | Biorad | Cat# 5678084 |
| 10X Tris Glycine SDS Running Buffer | Biorad | Cat# 1610732 |
| 10X Tris Buffered Saline | Biorad | Cat# 1706435 |
| Fish Gelatin | Millipore Sigma | Cat# G7765 |
| Casein | Millipore Sigma | Cat# C0626 |
| Sodium Nitrate | Millipore Sigma | Cat# S8032 |
| Thiamine Pyrophosphate | Millipore Sigma | Cat# C8754 CAS# 154-87-0 |
| Pyridoxal 5′-phosphate | Millipore Sigma | Cat# P9255 CAS# 853645-22-4 |
| Trichostatin A | Millipore Sigma | Cat# T8552 CAS# 58880-19-6 |
| D-(+)-Glucose Solution | Millipore Sigma | Cat# G8769 CAS# 50-99-7 |
| Roche cOmplete ULTRA EDTA-free Protease Inhibitor Mini Tablet | Millipore Sigma | Cat# 05892791001 |
| Roche 1x PhosSTOP Phosphatase Inhibitor Cocktail Tablets | Millipore Sigma | Cat# 04906837001 |
| Barium Hydroxide (0.3N) | Millipore Sigma | Cat# B4059 CAS #17194-00-2 |
| Zinc Sulfate (0.3N) | Millipore Sigma | Cat# Z2976 CAS #7733-02-0 |
| Lysyl Endopeptidase, Mass Spectrometry Grade | Wako Chemicals | Cat# 125-05061 |
| Sequencing Grade Modified Trypsin | Promega | Cat# V5113 |
| tC18 SEP-PAK Solid Phase Extraction Columns (50 mg) | Waters | Cat# WAT054960 |
| tC18 SEP-PAK Solid Phase Extraction Columns (100 mg) | Waters | Cat# WAT036820 |
| Triethylammonium bicarbonate (TEAB) | ThermoFisher | Cat# 90114 |
| TMT10plex™ Isobaric Label Reagent Set (0.8 mg per tag) | ThermoFisher | Cat# 90110 |
| MyTaq Red 2x Mix | Bioline | Cat# BIO-25044 |
| TRIzol Reagent | ThermoFisher | Cat# 15596026 |
| iTaq Universal SYBR Green Supermix | Biorad | Cat# 172-5121 |
| Humulin R U-500 | Lilly USA | |
| [3-3H]glucose | PerkinElmer | Cat# NET331C |
| 2[14C]deoxyglucose | PerkinElmer | Cat# NEC720A |
| UltimaGold Scintillation Fluid | PerkinElmer | Cat# 6013371 |
| Experimental Models: Organisms/Strains | ||
| C57BL/6NJ mice | The Jackson Laboratory | Stock #005304 |
| Skeletal Muscle and Heart Specific Double Knock-Out Mice for CrAT and Sirt3 Genes |
|
|
| Skeletal Muscle and Heart Specific Sirt3 Knock-Out Mice |
|
|
| Software and Algorithms | ||
| Web-based ΔGATP calculator | Fisher-Wellman et al., 2018 | https://dmpio.github.io/bioenergetic-calculators/ck_clamp/ |
| Proteome Discoverer 2.2 | ThermoFisher | N/A |
| Proteomic Statistical Analysis | This Publication* | https://github.com/dmpio/Williams_et_al_2019_Kac_PRX |
| CalR | Mina et al., 2018 |
https://calrapp.org |
| Other | ||
| QuantaMaster Spectrofluorometer | Horiba Scientific | Cat# QM-400 |
| TissueLyser II | Qiagen | Cat# 85300 |
| Oxygraph-2k | Orosboros Instruments | Cat# O2k-Core |
| Promethion Behavioral Phenotyping Mouse System | Sable Systems Int. | N/A |
| Tri-Carb 2900TR Liquid Scintillation Counter | PerkinElmer | N/A |
| Spectromax M2E Spectrophotometer | Molecular Devices | N/A |
| Gas Chromatography Mass Spectrometer | Agilent | Cat# 7890B GC-5977A MSD |
| Bio-Rad Turboblot Transfer System | Biorad | Cat# 1704150EDU |
| Thermo Scientific LTQ Orbitrap XLTM Mass Spectrometer | ThermoScientific | N/A |
| Waters nanoACQUITY Ultra Performance LC (nanoACQUITY UPLC) | ThermoScientific | N/A |
| Deposited Data | ||
| Proteomics Raw Data Files |
This Publication | PRIDE Accession: PXD014586 |
| Oligonucleotides | ||
| Sirt3 RT-qPCR: Fwd: AGGTGGAGGAAGCAGTGAGA | Fernandez-Marcos et al. 2012 | N/A |
| Sirt3 RT-qPCR: Reverse: GCTTGGGGTTGTGAAAGAAA | Fernandez-Marcos et al. 2012 | N/A |
| 18S RT-qPCR: Fwd: GTA ACC CGT TGA ACC CCA | This paper | N/A |
| 18S RT-qPCR: Reverse: CCA TCC AAT CGG TAG TAG CG | This paper | N/A |
| Critical Commercial Assays | ||
| TaqMan Gene Expression Assay on Demand for CrAT | ThermoFisher | Assay ID Mm00483985_m1 |
| Pierce Quantitative Colorimetric Peptide Assay | ThermoFisher | Cat# 23275 |
| PTMScan Acetyl-Lysine Motif [Ac-K] Kit | Cell Signaling Technology | Cat# 13416 |
| Pierce High pH Reversed-Phase Peptide Fractionation Kit | ThermoFisher | Cat# 84868 |
| RNeasy Mini Kit | Qiagen | Cat# 74106 |
| ALPCO STELLUX Chemi Rodent ELISA Kit | ALPCO | Cat# 80-INSMR-CH01 |
| iSCRIPT cDNA Synthesis Kit | Biorad | Cat# 1708840 |
*
The repository is currently private, so only individuals with a Github account and access to the DMPI repository can access the link at the moment. When the manuscript is accepted for publication, the repository will be made public, with full access to all files at the address: https://github.com/dmpio/Williams_et_al_2019_Kac_PRX