KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| mouse monoclonal anti-β-catenin | BD transduction Laboratories | Cat#610154; RRID: AB_397555 |
| rabbit polyclonal anti-Desmoglein 1 (clone H290) | Santa Cruz Biotechnology | Cat#SC-20114; RRID: AB_2293011 |
| mouse monoclonal anti-α-catenin | BD transduction Laboratories | Cat#610193; RRID: AB_397592 |
| rabbit polyclonal anti-cytokeratin 5 | abcam | Cat#ab24647; RRID: AB_448212 |
| rabbit polyclonal anti-cytokeratin 17 | abcam | Cat#ab53707; RRID: AB_869865 |
| mouse monoclonal anti-cytokeratin 75 | Santa Cruz Biotechnology | Cat# SC-166074; RRID: AB_2134713 |
| rabbit polyclonal anti-Connexin 43 | abcam | Cat#ab11370; RRID: AB_297976 |
| mouse monoclonal anti-Integrin α-6 | Developmental Studies Hybridoma Bank | Cat#P2C62C4; RRID: AB_528301 |
| rabbit polyclonal anti-Focal adhesion kinase | abcam | Cat#ab4803; RRID: AB_304640 |
| mouse monoclonal anti-L-CAM | Developmental Studies Hybridoma Bank | Cat#7D6; RRID: AB_528115 |
| mouse monoclonal anti-Laminin 5 (clone D4B5) | Millipore | Cat#MAB19562; RRID: AB_94454 |
| goat polyclonal anti-mouse IgG secondary antibody, Alexa Fluor 488 | Thermo Fisher Scientific | Cat#R37120; RRID: AB_2556548 |
| goat polyclonal anti-rabbit IgG secondary antibody, Alexa Fluor 488 | Thermo Fisher Scientific | Cat#R37116; RRID: AB_2556544 |
| goat polyclonal anti-rabbit IgG secondary antibody, Alexa Fluor 546 | Thermo Fisher Scientific | Cat#; A-11035; RRID: AB_2534093 |
| Bacterial and Virus Strains | ||
| RCAS-BMP4 | P. Francis-West (Department of Craniofacial Dev. And Stem Cell Biol. King’s College, London) | N/A |
| RCAS-Ski | K. Luo (Department of Mol. Cell Biol., UC Berkeley, Berkeley, Ca) | N/A |
| Biological Samples | ||
| three months to one-year old male Taiwan Country chicken | integrative Evolutionary Galliform Genomics (iEGG), National Chung Hsing University, Taiwan | N/A |
| one-year ole male mandarin duck | iEGG, National Chung Hsing University, Taiwan | N/A |
| Amber embedded feather | This paper | CNU A0012 |
| Amber embedded feather | This paper | CNU A0013 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Bisdemethoxycurxumin (BDMC) | Cayman chemical | Cat#10960;CAS33171-05-0 |
| Focal adhesion kinase inhibitor | Sigma-Aldrich | Cat#PF-573228; CAS: 869288-64-2 |
| Bovine serum albumin (BSA) | Sigma-Aldrich | Cat#12657; CAS9048-46-8 |
| Affi-Gel® Blue Gel | BIO-RAD | Cat#1537301; CAS: 7732-18-5 |
| Fluoroshield with DAPI | Sigma-Aldrich | Cat#F6057 |
| Trizol | Thermo Fisher Scientific | Cat#15596026 |
| TruSeq RNA Library Preparation Kit v2 | Illumnia | Cat#RS-122-2001 |
| SuperScript III Reverse Transcriptase | Thermo Fisher Scientific | Cat#18080093 |
| LightCycler® 480 SYBR Green I Master | Roche | Cat# 04707516001 |
| Wnt-2b peptide (Ser57-Yhr389) | R&D | Cat#3900-WN/CF; GenPept: O70283 |
| Proteinase K | Roche | Cat#10109495001 |
| Paraformaldehyde | Sigma-Aldrich | Cat#P6148 |
| Triethanolamine | Sigma-Aldrich | Cat#T1502 |
| Acetic anhydride | Alfa Aesar | Cat# 36292-AP |
| Formamide | Sigma-Aldrich | Cat#F9037 |
| Tween 20 | Sigma-Aldrich | Cat#P9416 |
| tRNA | Roche | Cat#10109495001 |
| Blocking reagent | Roche | Cat#11096176001 |
| NBT/BCIP | Promega | Cat#S3771 |
| Fetal Bovine Serum | Gemini | Cat#100-106 |
| Phosphate buffered saline | BioPioneer | Cat#MB1011-10X |
| SSC Buffer | BioPioneer | Cat#MB1028 |
| Deposited Data | ||
| RNA-seq raw data | This paper | GEO: GSE111008 |
| Oligonucleotides | ||
| Primer: WNT2B Forward: CTCCTCGTGGTGGTACATCG | This paper | N/A |
| Primer: WNT2B Reverse: ATTGGTACTGGCACTCACGG | This paper | N/A |
| Primer: WNT3A Forward: TCATCCCGCCTCGGAAGAAA | This paper | N/A |
| Primer: WNT3A Reverse: AGAGCCTGACTCAACCCACA | This paper | N/A |
| Primer: WNT4 Forward: CGAGCTGGACAAGTGTGGAT | This paper | N/A |
| Primer: WNT4 Reverse: CTCCTCGTGGTGGTACATCG | This paper | N/A |
| Primer: WNT7A Forward: GGTCTCGGGATCCTGTACCA | This paper | N/A |
| Primer: WNT7A Reverse: TGAGGAAGGTTGGACGCTTG | This paper | N/A |
| Primer: WNT11 Forward: GACCTGGGTATCGATGGGGA | This paper | N/A |
| Primer: WNT11 Reverse: GGCTTTCAAGACCTGTCTCC | This paper | N/A |
| Primer: FZD10 Forward: CTGTGACAGGGACAGTGGTC | This paper | N/A |
| Primer: FZD10 Reverse: TAACCCACCACAAGGAACTGG | This paper | N/A |
| Primer: SFRP4 Forward: CCTCTGTTTGCAGATGGGAAG | This paper | N/A |
| Primer: SFRP4 Reverse: GTTCTTGGCCAGGTAGGTCG | This paper | N/A |
| Primer: SFRP5 Forward: CCCAGGCTGTGTTCAAGGAA | This paper | N/A |
| Primer: SFRP5 Reverse: ACAGAGGGTGGGAGTATGGG | This paper | N/A |
| Primer: DKK1 Forward: GCGACTGATTGCAGTACGTT | This paper | N/A |
| Primer: DKK1 Reverse: TGGAAACTCAGCGCGTACC | This paper | N/A |
| Primer: DKK2 Forward: AAGTGGCTAATGGTGCCGC | This paper | N/A |
| Primer: DKK2 Reverse: TAGCAAGCTTCAGTCCCTGG | This paper | N/A |
| Primer: AXIN2 Forward: GCTTACATGAGCAGCAACGG | This paper | N/A |
| Primer: AXIN2 Reverse: CGTAACCCTCAGCGTTTTGC | This paper | N/A |
| Primer: LGR6 Forward: TAAAGTCCCTGCTCGCCGAT | This paper | N/A |
| Primer: LGR6 Reverse: AACCTGCAACCAGGCCAGAC | This paper | N/A |
| Software and Algorithms | ||
| Partek Genomic Suite | Partek | https://www.partek.com/pgs |
| KEGG pathway analysis | N/A | http://www.genome.jp/kegg |
| Ingenuity pathways analysis (IPA) | N/A | https://www.qiagenbioinformatics.com/products/ingenuity-pathway-analysis/ |
| Octopus Imaging | XRE NV, Belgium | N/A |
| MetaMorph | Molecular Devices, USA | N/A |
| PhotoShop CS6 | Adobe, San Jose, CA, USA | N/A |
| Computer-aided-design | SolidWorks 2016, MA, USA | N/A |
| Finite element | ANSYS Workbench, USA | N/A |
| Adobe Illustrator 4.0 | N/A | https://www.adobe.com/downloads.html |