TABLE 3.
Phenotypes of wild-type ϕX174, ϕXG4J, and ϕXG4J with genome duplications and inserts
| Mutant | Genome (ϕX174) |
Inserted sequence | Plating efficiencya (ϕXJ gene expression) |
||
|---|---|---|---|---|---|
| Size (no. of nucleotides) | Content (%) | With | Without | ||
| ϕX174 | 5,386 | 100 | 1.0 | 1.0 | |
| ϕX174 G4J | 5,344 | 99.2 | 1.0 | 10–5 | |
| ϕXG4J dup21 | 5,364 | 99.6 | AGGATAAATTAATGTCTAAT | 1.0 | 1.0 |
| ϕXG4J dup24 | 5,368 | 99.6 | AGGATAAATTAATGTCTAATATTC | 1.0 | 1.0 |
| ϕXG4J dup210 | 5,554 | 103.8 | AGGATAAATTAATGTCTAAT+190 | 1.0 | 1.0 |
| ϕXG4J scrambled | 5,364 | 99.6 | GAATTATAGTAGTATAACTA | 1.0 | <10–4 |
| ϕXG4J+42H | 5,386 | 100 | Tolerated 42-nucleotide insert in gene H | 1.0 | <10–4 |
a
Plating efficiency, assay titer/titer on cells expressing the cloned ϕX174 J gene.