. 2020 Jan 9;8:321. Originally published 2019 Mar 22. [Version 2] doi: 10.12688/f1000research.18445.2

Table 1. Sequence of ssDNA targets and guide DNAs used in this work.

Table shows the names and sequence of the two target DNA used in this work (T-45 and T-50) and the oligonucleotides used as gDNA. All the gDNA except for 21-OH and 20-OH are phosphorylated at their 5’ end, being labelled as [phos].

Name	Sequence (5´-3´)	Description
`T-45`	`AAACGACGGCCAGTGCCAAGCTTACTATACAACCTACTACCTCAT`	`DNA target`
`T-50`	`GGTCGCGGAGGTTATGGATGCGATCGCTGCGGCCGATCTTAGCCAGACGA`	`DNA target`
`W-1`	`[phos]-TGAGGTAGTAGGTTGTATAGT`	`DNA guide to 1 nt of 3'-target`
`W-2`	`[phos]-GAGGTAGTAGGTTGTATAGTA`	`DNA guide to 2 nt of 3'-target`
`W-3`	`[phos]-AGGTAGTAGGTTGTATAGTAA`	`DNA guide to 3 nt of 3'-target`
`W-4`	`[phos]-GGTAGTAGGTTGTATAGTAAG`	`DNA guide to 4 nt of 3'-target`
`W-5`	`[phos]-GTAGTAGGTTGTATAGTAAGC`	`DNA guide to 5 nt of 3'-target`
`W-6`	`[phos]-TAGTAGGTTGTATAGTAAGCT`	`DNA guide to 6 nt of 3'-target`
`W-7`	`[phos]-AGTAGGTTGTATAGTAAGCTT`	`DNA guide to 7 nt of 3'-target`
`W-8`	`[phos]-GTAGGTTGTATAGTAAGCTTG`	`DNA guide to 8 nt of 3'-target`
`20-P`	`[phos]GAGGTAGTAGGTTGTATAGT`	`DNA guide to 2 nt of 3'-target`
`21-OH`	`TGAGGTAGTAGGTTGTATAGT`	`DNA guide to 1 nt of 3'-target`
`20-OH`	`GAGGTAGTAGGTTGTATAGT`	`DNA guide to 2 nt of 3'-target`
`Hy 10-7`	`[phos]CGTCTGG`	`7 nt DNA guide`
`Hy10-9`	`[phos]CGTCTGGCT`	`9 nt DNA guide`
`Hy10-11`	`[phos]CGTCTGGCTAA`	`11 nt DNA guide`
`Hy10-13`	`[phos]CGTCTGGCTAAGA`	`13 nt DNA guide`
`Hy10-15`	`[phos]CGTCTGGCTAAGATC`	`15 nt DNA guide`
`Hy10-17`	`[phos]CGTCTGGCTAAGATCGG`	`17 nt DNA guide`
`Hy10-19`	`[phos]CGTCTGGCTAAGATCGGCC`	`19 nt DNA guide`
`Hygro-1`	`[phos]TGGTCGCGGAGGTTATGGATGCGATCGCT`	`DNA guide (Fw)`
`Hygro-2`	`[phos]TCATCCATAACCTCCGCGACCGGTTGCAG`	`DNA guide (Rv)`
`Hygro-3`	`[phos]GGTCGCGGAGGTTATGGATGCGATCGCT`	`DNA guide (Fw)`
`Hygro-4`	`[phos]CATCCATAACCTCCGCGACCGGTTGCAG`	`DNA guide (Rv)`