Table 1.
Characteristics of real-time PCR primers in this study.
| Primer Name | Locationa | Sequence (5ʹ-3ʹ) | TMelt (°C) |
|---|---|---|---|
| h18S.1b | 4068 | GGAATCAGGGTTCGATTCCG | 55.6 |
| h18S.2 | rc(4128)c | GCCTTCCTTGGATGTGGTAG | 55.4 |
| h18S.3 | 4709 | CGATCAGATACCGTCGTAGTTC | 54.5 |
| h18S.4 | rc(4780) | GGTCATGGGAATAACGCCGC | 59.0 |
| h28S.1 | 11648 | GAAGCGCGGGTAAACGGC | 60.0 |
| h28S.2 | rc(11708) | TGACGAGGCATTTGGCTACC | 57.6 |
| h5S.1 | 10 | CATACCACCCTGAACGCGCC | 61.2 |
| h5S.2 | rc(65) | CCGACCCTGCTTAGCTTCCG | 60.4 |
| htM-AUG.1d | 5 | GAGTGGCGCAGCGGAAGCGTGCTGG | 70.0 |
| htM-AUG.2 | rc(70) | GCAGAGGATGGTTTCGATCCATCG | 59.7 |
| d18S.1b | 1260 | AGCCTGAGAAACGGCTACCA | 58.6 |
| d18S.2 | rc(1323) | AGCTGGGAGTGGGTAATTTACG | 56.8 |
| d28S.1 | 6807 | ACGCGCATGAATGGATTAAC | 53.8 |
| d28S.2 | rc(6893) | AATTATTCCAAGCCCGTTCC | 53.1 |
| dtM-AUG.1 | 12 | GCAGTTGGCGCGCGTAAG | 60.4 |
| dtM-AUG.2 | rc(69) | CCGGGTGAGGCTCGAAC | 58.6 |
aLocation refers to the beginning of the alignment of the first nucleotide of the primer with the primary pre-rRNA transcripts (35S/45S or 5S). For the tRNA gene, the location is relative to the mature tRNA.
bPrefix ‘h’ indicates a primer specific to human rDNA, ‘d’ indicates Drosophila.
crc(N) indicates that the first nucleotide of the primer aligns with the indicated nucleotide (N) of the reverse-complement of the primary transcript.
dThis primer set detects the initiator Met isotype (tRNA-iMet-CAT-1–1 through tRNA-iMet-CAT-1–8, and likely also tRNA-iMet-CAT-2–1).