Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Homo-sapiens) | Hs578T, breast cancer | ATCC | HTB-126, RRID:CVCL_0332 | Authenticated by ATCC |
| Cell line (Homo-sapiens) | MDA-MB-453, breast cancer | ATCC | HTB-131, RRID:CVCL_0418 | Authenticated by ATCC |
| Cell line (Homo-sapiens) | MCF7, breast cancer | ATCC | HTB-22, RRID:CVCL_0031 | Authenticated by ATCC |
| Cell line (Homo-sapiens) | HCC1569, breast cancer | ATCC | CRL-2330, RRID:CVCL_1255 | Authenticated by ATCC |
| Cell line (Homo-sapiens) | LentiX-293T | Clontech | 632180 | Mycoplasma free |
| Strain, strain background (Escherichia coli) | MBM7070 (lacZuag_amber) | Gift from Dr Michael Seidman (NIH) | Electroporation | |
| Strain, strain background (Escherichia coli) | Rosetta (DE3) | Millipore | 70954–4 | Protein expression |
| Antibody | anti-HA (Rabbit polyclonal) | Sigma-Aldrich | H6908, RRID:AB_260070 | WB (1:1,000) |
| Antibody | anti-Exo1 (Rabbit polyclonal) | Proteintech | 16253–1-AP, RRID:AB_2278140 | WB (1:1000) |
| Antibody | anti-Lamin B1(Rabbit polyclonal) | abcam | ab16048, RRID:AB_10107828 | WB (1:2,000) |
| Antibody | anti-Rabbit IgG-Peroxidase | Sigma-Aldrich | A0545, RRID:AB_257896 | WB (1:10,000) |
| Antibody | anti-Mouse IgG-Peroxidase | Sigma-Aldrich | A4416, RRID:AB_258167 | WB (1:5,000) |
| Antibody | anti-γH2AX | Cell Signaling | 2577, RRID:AB_2118010 | IF (1:800) |
| Antibody | Alexa Fluor 568 anti-Rabbit IgG Secondary Antibody | Invitrogen | A-11036, RRID:AB_143011 | IF (1:500) |
| Sequenced-based reagent | siSCR (negative control) | Dharmacon | UAGCGACUAAACACAUCAA | |
| Sequenced-based reagent | siA3B | Dharmacon | J-017322-08-0005 | A3B knockdown |
| Sequenced-based reagent | siA3C | Dharmacon Muckenfuss et al., 2006 |
AAGCCAACGAUCGGAACGAAA | |
| Sequenced-based reagent | siNEIL2 | Dharmacon | GCGAGGAUGAUUCUGAGUA | |
| Sequenced-based reagent | siTREX1 | Dharmacon | ACAAUGGUGACCGCUACGA | |
| Sequenced-based reagent | siExo1 | Dharmacon | CAAGCCUAUUCUCGUAUUU | |
| Commercial assay or kit | A3A_TaqMan | ThermoFisher Scientific | Hs02572821_s1 | |
| Commercial assay or kit | A3B_TaqMan | ThermoFisher Scientific | Hs00358981_m1 | |
| Commercial assay or kit | A3C_TaqMan | ThermoFisher Scientific | Hs00819353_m1 | |
| Commercial assay or kit | A3H_TaqMan | ThermoFisher Scientific | Hs00419665_m1 | |
| Commercial assay or kit | NEIL2_TaqMan | ThermoFisher Scientific | Hs00979610_g1 | |
| Commercial assay or kit | Exo1_TaqMan | ThermoFisher Scientific | Hs01116190_m1 | |
| Commercial assay or kit | TREX1_TaqMan | ThermoFisher Scientific | Hs03989617_s1 | |
| Commercial assay or kit | GAPDH_TaqMan | ThermoFisher Scientific | Hs02786624_g1 | |
| Commercial assay or kit | TBP_TaqMan | ThermoFisher Scientific | Hs00427620_m1 | |
| Recombinant DNA reagent | pLKO.1 | addgene | RRID:Addgene_10878 | shRNA construction |
| Recombinant DNA reagent | pMDLg/pRRE | addgene | RRID:Addgene_12251 | lentivirus packaging |
| Recombinant DNA reagent | pRSV-Rev | addgene | RRID:Addgene_12253 | lentivirus packaging |
| Recombinant DNA reagent | pMD2.G | addgene | RRID:Addgene_12259 | lentivirus packaging |
| Transfected construct (Homo-sapiens) | phAPOBEC3B-HA (A3B-3HA) | NIH AIDS Reagent Program | 11090 | A3B overexpression |
| Transfected construct (Homo-sapiens) | pPM-NEIL2-3’HA | abm | PV028075 | NEIL2 rescue in mutation rate assay |
| Transfected construct (Homo-sapiens) | pcDNA3.1(+)-NEIL2-3’HA | this paper | NEIL2 rescue in γH2AX assay | |
| Transfected construct (Homo-sapiens) | pET22b-NEIL2 | Gift from Dr Tapas Hazra (U of Texas) | NEIL2 expression and purification from E. coli | |
| Transfected construct (Homo-sapiens) | pET28a(+)-PNKP | this paper | For PNKP expression and purification | |
| Transfected construct (Homo-sapiens) | pET28a(+)-Polβ | this paper | For Polβ expression and purification |