Table 1.

Quantitative RT-PCR assay details

Gene	Description (Protein Abbreviation)	Forward Primer (5′ to 3′)	Reverse Primer (5′ to 3′)	Probe, bp
Rn18s	18S rRNA	ctcaacacgggaaacctcac	cgctccaccaactaagaacg	77
Tbp	TATA box-binding protein (TBP)	gggagaatcatggaccagaa	gatgggaattccaggagtca	97
Hprt1	Hypoxanthine-guanine phosphoribosyltransferase (HPRT)	cctcctcagaccgcttttt	aacctggttcatcatcgctaa	95
Per1	Period circadian protein homolog 1 (PER1)	gcttcgtggacttgacacct	tgctttagatcggcagtggt	71
Per2	Period circadian protein homolog 2 (PER2)	gcttcgtggacttgacacct	tgctttagatcggcagtggt	5
Clock-201	Circadian locomotor output cycles protein kaput (CLOCK)	ccagtcagttggtccatcatt	tggctcctaactgagctgaaa	76
Cry1	Cryptochrome 1 (CRY1)	ggcagagcagtaactgatacga	tgactttcccaccaacttca	52
Cry2	Cryptochrome 2 (CRY2)	ggagcatcagcaacacagg	ccgcttggtcagttcttcac	11
Arnt1 var1	Aryl hydrocarbon receptor nuclear translocator-like protein 1 (BMAL1)	gaatacattgtctcaaccaacactg	ttagctgcgggaaggttg	97
Nr1d1	Nuclear receptor subfamily 1 group D member 1 (Rev-erbα)	cgaccctggactccaataac	tgccattggagctgtcact	52
Nr1d2	Nuclear receptor subfamily 1 group D member 2 (Rev-erbβ)	stggagctgaacgcagga	tcagaaccctcactgtgacaa	16
Sgk1	Serum- and glucocorticoid-induced kinase 1 (SGK1)	gattgccagcaacacctatg	ttgatttgttgagagggacttg	91
Tsc22d3 v2	Glucocorticoid-induced leucine zipper protein (GILZ)	tccgttaaactggataacagtgc	tggttcttcacgaggtccat	49
Nr3c2	Mineralocorticoid receptor (MR)	caaaagagccgtggaagg	tttctccgaatcttatcaataatgc	11
Nr3c1	Glucocorticoid receptor (GR)	tgacgtgtggaagctgtaaagt	catttcttccagcacaaaggt	56
Hsd11b2	11β-Hydroxysteroid dehydrogenase type 2 (11βHSD2)	cactcgaggggacgtattgt	gcaggggtatggcatgtct	26
Slc12a3	Sodium-chloride cotransporter (NCC)	cctccatcaccaactcacct	ccgcccacttgctgtagta	12
Wnk4	With-no-lysine kinase 4 (WNK4)	tccgatttgatctggatgg	gggcaggatgaactcattgta	26

Assays were designed using the Roche Universal Probe library, and assays were run using Roche Universal Probe library probes.