Skip to main content
. 2019 Nov 21;11(12):1838. doi: 10.3390/cancers11121838

Table 1.

Clinical data, molecular details, mutation type, and mutation location by tertile and domain.

ID Code Age Sex OPG DNA Change RNA Change Protein Change Type Tertile Domain
162 60 f yes c.1-?_60+? del r.(?) p.(?) LD 1 nd
6 30 f yes c.21_22delGG r.(?) p.Glu8Metfs*29 FS 1 nd
112 15 f yes c.60+1G>A r.(?) p.(?) SS 1 nd
Calì et al. 1 [38] 29 f yes c.61-2A>C r.(?) p.(?) SS 1 nd
8 12 f yes c.61-?_204+?del r.61_204del p.Leu21_Met68del LD 1 nd
24 31 f no c.61-?_288+?del r.61_288del p.Leu21_Gly96del LD 1 nd
139 6 f yes c.61-?_288+?del r.61_288del p.Leu21_Gly96del LD 1 nd
Bonatti et al. 1 [37] na m yes c.61-?_2325+?del r.(?) p.Leu21_Glu775del LD 1 CSRD
Tsipi et al. 38 [33] 55 na no c.86_87delAC r.(?) p.His31Tyrfs*6 FS 1 nd
136 35 f no c.99A>G r.100_204del p.Val34_Met68del SS 1 nd
177 11 f yes c.185dupT r.(?) p.Leu62Phefs*5 FS 1 nd
76 42 f no c.205_288del r.205_288del p.Arg69_Gly96del LD 1 nd
153 21 m no c.236T>G r.(?) p.Leu79* NS 1 nd
46 36 f yes c.247C>T r.(?) p.Gln83* NS 1 nd
65 9 f yes c.247delCinsGAGA r.(?) p.Gln83delinsGluLys ID 1 nd
30 53 m no c.252delG r.(?) p.Ile85fs*18 FS 1 nd
127 59 m no c.259_264delTTGGATinsAA r.259_264deluuggauinsaa p.Leu87Lysfs*15 FS 1 nd
109 71 f no c.288+1delG r.288_288del p.Gln97Asnfs*6 SS 1 nd
250 34 m no c.288+5G>A r.205_288del p.Arg69_Gly96del SS 1 nd
256 26 f no c.288+5G>C r.(?) p.(?) SS 1 nd
244 33 m no c.288+1138C>T r.288_289 ins 288+1019_288+1136ins118 p.Gly96_Glu 97ins39aa+fs *10 SS 1 nd
Tsipi et al. 114 [33] 7 na yes c.350_351insT r.(?) p.Cys118Leufs*9 FS 1 nd
79 35 f yes c.479G>T r.289_479del p.Gln97Valfs*13 SS 1 nd
31 75 f no c.484C>T r.(?) p.Gln162* NS 1 nd
7 44 m no c.493delA r.(?) p.Thr165Leufs*13 FS 1 nd
131 50 f no c.495_498delTGTT r.495_498del p.Thr166fs*11 FS 1 nd
68 28 f yes c.495_498delTGTT r.495_498del p.Thr166fs*11 FS 1 nd
61 39 f no c.499_502delTGTT r.(?) p.Cys167Glnfs*10 FS 1 nd
183 26 m no c.499_502delTGTT r.(?) p.Cys167Glnfs*10 FS 1 nd
Terzi et al. 23 [40] na na yes c.499_502delTGTT r.(?) p.Cys167Glnfs*10 FS 1 nd
Tsipi et al. 90 [33] 15 na yes c.501T>A r.(?) p.Cys167* NS 1 nd
171 29 m no c.539T>G r.539u>g p.Leu180* NS 1 nd
44 57 f no c.574C>T r.574c>u p.Arg192* NS 1 nd
57 44 f no c.574C>T r.574c>u p.Arg192* NS 1 nd
160 17 f yes c.574C>T r.574c>u p.Arg192* NS 1 nd
188 56 f no c.586+1G>T r.(?) p.(?) SS 1 nd
180 44 m no c.586+4dupA r.(?) p.(?) SS 1 nd
193 46 f no c.647_649delTGG r.(?) p.Leu216_Glu217delinsGln ID 1 nd
175 27 f no c.615_616delGAinsAT r.587_654del p.Glu196Glyfs*12 SS 1 nd
85 42 m no c.649delG r.(?) p.Glu217Lysfs*8 FS 1 nd
144 38 f no c.652_653delAAinsG r.(?) p.Lys218Glyfs*7 FS 1 nd
Tsipi et al. 156 [33] 4 na yes c.653_653insA r.(?) p.Lys218Argfs*7 FS 1 nd
215 11 m no c.681T>G r.(?) p.Tyr227* NS 1 nd
1 25 m yes c.801delG r.(?) p.Trp267Cysfs*14 FS 1 nd
253 59 f no c.910C>T r.(?) p.Arg304* NS 1 nd
118 30 f no c.910C>T r.(?) p.Arg304* NS 1 nd
129 38 m yes c.945_946delGCinsAA r.889_1062del p.Lys297_Lys354del SS 1 nd
228 15 m no c.952_953delGA r.(?) p.Glu318fs*11 FS 1 nd
135 15 m yes c.952_953delGA r.(?) p.Glu318fs*11 FS 1 nd
Tsipi et al. 102 [33] 44 na no c.968C>A r.(?) p.Ala323Asp MS 1 nd
224 15 m no c.980T>C r.980u>c p.Leu327Pro MS 1 nd
120 15 m yes c.980T>C r.980u>c p.Leu327Pro MS 1 nd
212 15 f no c.998_999insA r.998_999insa p.Tyr333* FS 1 nd
199 4 f yes c.1007G>A r.(?) p.Trp336* NS 1 nd
35 35 f no c.1019_1020delCT r.(?) p.Ser340Cysfs*12 FS 1 nd
106 20 m no c.1021_1022delGT r.(?) p.Val341Hisfs*11 FS 1 nd
Tsipi et al. 78 [33] 15 na no c.1022_1023insGA r.(?) p.Ile342Thrfs*35 FS 1 nd
166 na f no c.1062G>T r.889_1062del p.Lys297_Lys354del SS 1 nd
105 48 f yes c.1062+113A>G r.1062_1063ins113 p.Asn355Valfs*12 SS 1 nd
170 18 m no c.1063-2A>C r.(?) p.(?) SS 1 nd
84 44 f no c.1122_1125delTCTA r.1122_1125del p.Asp374Glufs*2 FS 1 nd
74 36 f no c.1140delT r.(?) p.Val381Phefs*6 FS 1 nd
Bonatti et al. 15 [37] na m yes c.1144delT r.(?) p.Ser382Leufs*5 FS 1 nd
Tsipi et al. 126 [33] 28 na no c.1182_1183insT r.(?) p.Lys395* FS 1 nd
59 45 f no c.1186-1G>C r.1186_1200del p.Ile396_Gln400del SS 1 nd
51 9 m yes c.1246C>T r.1246c>u p.Arg416* NS 1 nd
208 10 f no c.1246C>T r.1246c>u p.Arg416* NS 1 nd
238 20 m no c.1249delA r.(?) p.Ile417Serfs*56 FS 1 nd
39 21 m yes c.1259_1260insT r.(?) p.Ser421fs*8 FS 1 nd
Tsipi et al. 112 [33] 43 m yes c.1275G>A r.(?) p.Trp425* NS 1 nd
81 56 m no c.1315C>T r.(?) p.Leu439Phe MS 1 nd
240 40 f yes c.1318C>T r.1318c>u p.Arg440* NS 1 nd
60 66 m no c.1318C>T r.1318c>u p.Arg440* NS 1 nd
237 4 m yes c.1381C>T r.1381c>u p.Arg461* NS 1 nd
206 4 m yes c.1381C>T r.1381c>u p.Arg461* NS 1 nd
233 12 m no c.1392+1G>A r.(?) p.(?) SS 1 nd
178 31 m no c.1392+1G>T r.(?) p.Ser421_Pro464del SS 1 nd
58 16 f no c.1393-3_1393-2delTA r.1393_1527del p.Ser465_Cys509del SS 1 nd
124 53 f no c.1393-?_2325+?del r.(?) p.Ser465_Glu775del LD 1 CSRD
17 40 f no c.1399_1400insA r.(?) p.Thr467Asnfs*3 FS 1 nd
200 9 f yes c.1453G>T r.(?) p.Glu485* NS 1 nd
Bonatti et al. 22 [37] na m yes c.1462delA r.(?) p.Ser488Alafs*10 FS 1 nd
91 49 f no c.1466A>G r.1466_1527del p.Tyr489* SS 1 nd
96 13 f yes c.1466A>G r.1466_1527del p.Tyr489* SS 1 nd
Tsipi et al. 87 [33] 8 m yes c.1466A>G r.1466_1527del p.Tyr489* SS 1 nd
126 43 f no c.1466A>G r.1466_1527del p.Tyr489* SS 1 nd
172 46 m no c.1466A>G r.1466_1527del p.Tyr489* SS 1 nd
221 14 f no c.1466A>G r.1466_1527del p.Tyr489* SS 1 nd
Terzi et al. 679 [40] na na yes c.1525_1526insT r.(?) p.Cys509Leufs*2 FS 1 nd
104 61 m no c.1527+5G>A r.1393_1527del p.Ser465_Cys509del45 SS 1 nd
173 19 f yes c.1527+675C>T r.1527_1528ins116 p.Asp510Argfs17 SS 1 nd
187 39 f no c.1541_1542delAG r.(?) p.Gln514fs*21 FS 1 nd
157 21 f no c.1542delG r.(?) p.Lys514fs*10 FS 1 nd
145 5 m yes c.1549G>T r.1549g>u p.Glu517* NS 1 nd
163 10 m yes c.1603C>T r.(?) p.Gln535* NS 1 nd
93 19 m yes c.1658A>G r.1658a>g p.His553Arg MS 1 CSRD
Tsipi et al. 127 [33] 5 na yes c.1722-3C>A r.(?) p.(?) SS 1 CSRD
176 18 f no c.1722C>G r.(?) p.Ser574Arg MS 1 CSRD
Tsipi et al. 98 [33] 12 m yes c.1724C>A r.(?) p.Ser575* NS 1 CSRD
Tsipi et al. 44 [33] 58 na yes c.1755_1758delAACT r.(?) p.Thr586Valfs*18 FS 1 CSRD
89 3 m yes c.1756_1759delACTA r.(?) p.Thr586Valfs*18 FS 1 CSRD
169 18 f yes c.1756_1759delACTA r.(?) p.Thr586Valfs*18 FS 1 CSRD
226 18 f no c.1830_1833delTCTT r.(?) p.Leu612Lysfs*18 FS 1 CSRD
98 55 m no c.1840_1841insTTTT r.(?) p.Asn614llefs*2 FS 1 CSRD
14 38 m no c.1885G>A r.1885_1925del p.Gln616Glyfs*4 SS 1 CSRD
101 4 m yes c.1885G>A r.1885_1925del p.Gln616Glyfs*4 SS 1 CSRD
220 12 m no c.1885G>A r.1885_1925del p.Gln616Glyfs*4 SS 1 CSRD
Bonatti et al. 34 [37] na m yes c.1889T>A r.(?) p.Val630Glu MS 1 CSRD
143 16 f yes c.1907_1908delCT r.1907_1908del p.Ser636* FS 1 CSRD
125 36 f no c.2019delC r.(?) p.Cys673* FS 1 CSRD
Tsipi et al. 50 [33] 29 na no c.2033dupC r.2033dupc p.Ile679Aspfs*21 FS 1 CSRD
181 41 f no c.2033dupC r.2033dupc p.Ile679Aspfs*21 FS 1 CSRD
94 41 m no c.2033dupC r.2033dupc p.Ile679Aspfs*21 FS 1 CSRD
97 12 f yes c.2041C>T r.2041c>u p.Arg681* NS 1 CSRD
254 63 m no c.2041C>T r.2041c>u p.Arg681* NS 1 CSRD
203 8 f yes c.2041C>T r.2041c>u p.Arg681* NS 1 CSRD
156 72 m no c.2041C>T r.2041c>u p.Arg681* NS 1 CSRD
207 13 m no c.2041C>T r.2041c>u p.Arg681* NS 1 CSRD
102 29 f yes c.2084_2085delTG r.(?) p.Trp696Glufs*3 FS 1 CSRD
115 59 m no c.2106delT r.(?) p.Val703Phefs*45 FS 1 CSRD
161 13 f yes c.2131delC r.(?) p.Arg711Alafs*37 FS 1 CSRD
245 55 f no c.2251+1G>A r.2002_2251del p.Asp668Glufs*9 SS 1 CSRD
168 69 m no c.2297T>G r.(?) p.Ile766Ser MS 1 CSRD
26 52 m no c.2325G>C r.2252_2325del p.Arg752Leufs*17 SS 1 CSRD
Tsipi et al. 151 [33] 9 m yes c.2326-3T>G r.(?) p.(?) SS 1 CSRD
22 40 m no c.2329T>A r.(?) p.Trp777Arg MS 1 CSRD
236 12 m no c.2352G>C r.(?) p.Trp784Cys MS 1 CSRD
16 37 f no c.2356delC r.(?) p.Gln786fs*5 FS 1 CSRD
100 32 f no c.2409+1insCCC r.2326_2409del p.Ala776_Gln803del SS 1 CSRD
128 59 m no c.2409+1G>T r.2326_2409del p.Ala776_Gln803del SS 1 CSRD
235 12 f no c.2409+1G>T r.2326_2409del p.Ala776_Gln803del SS 1 CSRD
154 29 f yes c.2410-18C>G r.2409_2410ins2410-17_2410-1 p.Gln803fs*23 SS 1 CSRD
Calì et al. 25 [38] 7 m yes c.2446C>T r.(?) p.Arg816* NS 1 CSRD
55 50 f no c.2492_2493dupCA r.2492_2493dupca p.Asp832Glnfs*10 FS 1 CSRD
227 13 f no c.2537_2538ins TCAACATGACTGGCTTCCTTTGTGC r.2537_2538ins25 p.Leu847Glnfs*26 FS 1 CSRD
182 44 f no c.2540T>C r.2540u>c p.Leu847Pro MS 1 CSRD
73 21 f yes c.2540T>C r.2540u>c p.Leu847Pro MS 1 CSRD
90 18 m no c.2571delTinsAG r.(?) p.Ser858Leufs*7 FS 1 CSRD
231 18 m no c.2669delC r.2669del p.Pro890Leufs*12 FS 1 CSRD
5 21 m yes c.2674_2674delA r.2674_2674del p.Ser892Alafs*10 FS 1 CSRD
149 18 m no c.2693T>C r.(?) p.Leu898Pro MS 1 CSRD
67 51 f no c.2730_2731insAAGTGGGA r.(?) p.Leu911Lysfs*16 FS 1 nd
122 45 f no c.2850+1G>T r.2618_2850del p.Lys874Phefs*4 SS 1 CSRD
15 7 m yes c.2850G>A r.(?) p.Lys874Phefs*4 SS 1 CSRD
Tsipi et al. 124 [33] 11 na yes c.2858T>A r.(?) p.Leu953* NS 2 nd
246 45 f no c.2915T>C r.2915u>c p.Leu972Pro MS 2 nd
158 12 m yes c.2990+1G>T r.(?) p.(?) SS 2 nd
150 38 m yes c.2990+5G>C r.2851_2990del p.Leu952Cysfs*22 SS 2 nd
142 35 f no c.2991-2A>G r.(?) p.Tyr998_Arg1038del SS 2 nd
190 42 f no c.3047_3048delGT r.(?) p.Cys1016Serfs*4 FS 2 nd
251 25 m no c.3062_3063insGT r.(?) p.Met1022* FS 2 nd
Tsipi et al. 170 [33] 11 na no c.3076A>T r.(?) p.Arg1026* NS 2 nd
223 14 f no c.3104T>G r.3104u>g p.Met1035Arg MS 2 nd
Trevisson et al. I [35] 41 f no c.3112A>G r.(?) p.Arg1038Gly MS 2 nd
Trevisson et al. II [35] 30 f no c.3112A>G r.(?) p.Arg1038Gly MS 2 nd
10 14 m yes c.3168_3169insTA r.(?) p.Ala1057* FS 2 nd
29 8 f yes c.3198-2A>G r.3198_3199del p.Asp1067fs*20 SS 2 nd
Lin et al. 1 [41] 53 f no c.3236_3240dupTTCTA r.(?) p.Ala1081Phefs*2 FS 2 nd
134 17 f no c.3311T>G r.3311_3314del p.Leu1104Hisfs*7 SS 2 TBD
164 28 f no c.3456_3459delACTC r.3456_3459del p.Leu1153Metfs*4 FS 2 TBD
99 22 f yes c.3496+1G>A r.(?) p.Tyr1106Leufs*28 SS 2 TBD
217 12 f no c.3520C>T r.(?) p.Gln1174* NS 2 TBD
38 49 m no c.3574G>T r.(?) p.Glu1192* NS 2 TBD
138 33 f no c.3610C>G r.(?) p.Arg1204Gly MS 2 GRD
18 46 f no c.3708+1G>C r.3497_3708del p.Leu1167* SS 2 TBD
Ulusal et al. 7 [34] 57 f yes c.3709-2A>G r.3709_3718del p.Asp1237Leufs*26 SS 2 GRD
13 31 f yes c.3721C>T r.(?) p.Arg1241* NS 2 GRD
241 42 f yes c.3721C>T r.(?) p.Arg1241* NS 2 GRD
110 55 m no c.3739_3742delTGTT r.(?) p.Phe1247Ilefs*18 FS 2 GRD
42 16 m yes c.3826C>T r.3826c>u p.Arg1276* NS 2 GRD
165 35 m no c.3826C>T r.3826c>u p.Arg1276* NS 2 GRD
232 19 f no c.3826C>T r.3826c>u p.Arg1276* NS 2 GRD
243 50 m yes c.3826C>T r.3826c>u p.Arg1276* NS 2 GRD
191 43 f yes c.3826_3828delCGAinsTACT r.3826_3828delcgainsuacu p.Arg1276Tyrfs*8 FS 2 GRD
209 11 m no c.3827G>A r.3827g>a p.Arg1276Gln MS 2 GRD
54 61 m yes c.3827G>C r.(?) p.Arg1276Pro MS 2 GRD
49 22 m yes c.3844delA r.(?) p.Ser1282Valfs*3 FS 2 GRD
155 25 m yes c.3847delA r.(?) p.Ile1284* FS 2 GRD
88 45 f no c.3859delT r.(?) p.Phe1287Serfs*22 FS 2 GRD
Tsipi et al. 115 [33] 6 na yes c.3870_3871insTAG r.(?) p.Val1291* NS 2 GRD
50 46 m no c.3888T>G r.(?) p.Tyr1296* NS 2 GRD
70 6 f yes c.3916C>T r.3916c>u p.Arg1306* NS 2 GRD
36 59 m no c.3916C>T r.3916c>u p.Arg1306* NS 2 GRD
167 64 f no c.3941G>A r.(?) p.Trp1314* NS 2 GRD
192 26 m no c.3974+1G>A r.(?) p.(?) SS 2 GRD
83 40 f no c.3974+1G>T r.3871_3974del p.Tyr1292Argfs*8 SS 2 GRD
151 40 m no c.3974+2T>G r.(?) p.(?) SS 2 GRD
255 44 f no c.3975-2A>G r.3975_3979delguuag p.Leu1326Thrfs*6 SS 2 GRD
117 16 m yes c.3975-?_4110+? r.(?) p.Leu1326Trpfs*14 LD 2 GRD
219 11 m no c.3983_3986delCATC r.3983_3986del p.Pro1328Glnfs*14 FS 2 GRD
77 67 f yes c.3989_3992delAGAG r.(?) p.Glu1330Alafs*12 FS 2 GRD
132 46 f no c.4054delA r.(?) p.Ser1352Valfs*3 FS 2 GRD
9 38 m yes c.4084C>T r.(?) p.Arg1362* NS 2 GRD
21 10 f yes c.4084C>T r.(?) p.Arg1362* NS 2 GRD
116 10 f yes c.4084C>T r.(?) p.Arg1362* NS 2 GRD
Tsipi et al. 106 [33] 6 f yes c.4084C>T r.(?) p.Arg1362* NS 2 GRD
113 45 m no c.4084C>T r.(?) p.Arg1362* NS 2 GRD
140 30 f no c.4084C>T r.(?) p.Arg1362* NS 2 GRD
179 5 m yes c.4110+1G>C r.(?) p.(?) SS 2 GRD
Tsipi et al. 96 [33] 54 na no c.4134C>T r.(?) p.Gln1378* NS 2 GRD
189 31 f no c.4154delG r.4154del p.Gly1385Glufs*22 FS 2 GRD
Tsipi et al. 161 [33] 11 na yes c.4174G>C r.(?) p.Arg1391Thr MS 2 GRD
75 25 f yes c.4267A>G r.4267a>g p.Lys1423Glu MS 2 GRD
Tsipi et al. 177 [33] 6 m yes c.4269+1delG r.(?) p.(?) SS 2 GRD
Bonatti et al. 62 [37] na m yes c.4269+1G>C r.4111_4269del p.Val1371_Lys1423del SS 2 GRD
137 47 m no c.4353delT r.(?) p.Phe1451Leufs*11 FS 2 GRD
92 40 f no c.4402_4406delAGTGA r.4402_4406del p.Ser1468Cysfs*5 FS 2 GRD
72 5 m yes c.4435A>G r.4368_4435del p.Phe1457* SS 2 GRD
Tsipi et al. 95 [33] 6 na yes c.4474G>A r.(?) p.Trp1491* NS 2 GRD
147 46 m no c.4515-1G>A r.(?) p.(?) SS 2 GRD
196 56 m yes c.4537C>T r.4537c>u p.Arg1513* NS 2 GRD
211 10 m no c.4537C>T r.4537c>u p.Arg1513* NS 2 GRD
27 49 f no c.4537C>T r.4537c>u p.Arg1513* NS 2 GRD
47 17 m no c.4577delG r.(?) p.Gly1526Valfs*27 FS 2 GRD
123 34 m no c.4606dupA r.(?) p.Thr1536Asnfs*7 FS 2 nd
34 48 f no c.4630delA r.(?) p.Thr1544Profs*9 FS 2 nd
37 14 f yes c.4684G>T r.4684g>u p.Glu1562* NS 2 Sec14
146 19 m yes c.4817T>A r.(?) p.Val1606Asp MS 2 Sec14
213 14 m no c.4867G>C r.(?) p.Asp1623His MS 2 Sec14
Tsipi et al. 68 [33] 11 na no c.4959G>A r.(?) p.Val1653Ile MS 2 Sec14
64 18 m yes c.4983_4984dupT r.(?) p.Asn1662* FS 2 Sec14
121 23 f yes c.5028delG r.(?) p.Thr1677Leufs*12 FS 2 Sec14
202 7 f yes c.5047A>T r.(?) p.Lys1683* NS 2 Sec14
32 50 f no c.5154_5157dupATTC r.(?) p.His1720Ilefs*17 FS 2 PH
43 17 f no c.5170A>T r.(?) p.Lys1724* NS 2 PH
Tsipi et al. 39 [33] 35 na no c.5209T>G r.(?) p.Val1736Gly MS 2 PH
Terzi et al. 320 [40] na na yes c.5224C>T r.(?) p.Gln1742* NS 2 PH
Terzi et al. 325 [40] na na yes c.5224C>T r.(?) p.Gln1742* NS 2 PH
25 20 m no c.5242C>T r.(?) p.Arg1748* NS 2 PH
152 5 m yes c.5276delA r.5276del p.Asn1759Metfs*14 FS 2 PH
130 44 f no c.5353C>T r.(?) p.Gln1785* NS 2 PH
Tsipi et al. 129 [33] 3 m yes c.5382C>T r.(?) p.Gln1794* NS 2 PH
234 13 m no c.5425C>T r.(?) p.Arg1809Cys MS 2 PH
214 10 f no c.5426G>C r.(?) p.Arg1809Pro MS 2 PH
Tsipi et al.89 [33] 30 m yes c.5429G>A r.(?) p.Trp1810* NS 2 PH
41 30 f yes c.5471insT r.(?) p.Lys1823Asnfs*18 FS 2 nd
111 19 f no c.5483A>T r.(?) p.Asp1828Val MS 2 HLR
230 10 m no c.5520T>G r.5520u>g p.Asn1840Lys MS 2 HLR
133 10 m yes c.5543T>A r.(?) p.Leu1848* NS 2 HLR
Tsipi et al. 46 [33] 28 m yes c.5546G>A r.5206_5546del p.Gly1737fs*4 SS 2 PH
107 40 f no c.5546G>A r.5206_5546del p.Gly1737fs*4 SS 2 PH
Tsipi et al. 125 [33] 9 f yes c.5546+1G>A r.5206_5546del p.Gly1737fs*4 SS 2 PH
62 39 f no c.5546+5G>C r.(?) p.(?) SS 2 PH
45 19 f yes c.5594T>G r.5594u>g p.Leu1865* NS 2 HLR
48 33 m no c.5624C>G r.(?) p.Ser1875* NS 2 HLR
242 24 m yes c.5630delT r.(?) p.Leu1877Tyrfs*27 FS 2 HLR
222 16 f no c.5681T>C r.5681u>c p.Leu1894Pro MS 2 HLR
247 52 f no c.5750-177A>C r.5749_5750ins5750-174_5750-108 p.Ser1917Argfs*25 SS 2 HLR
28 14 f yes c.5815delT r.(?) p.Cys1939Aspfs*19 FS 3 HLR
205 14 f yes c.5839C>T r.5839c>u p.Arg1947* NS 3 HLR
3 42 m no c.5839C>T r.5839c>u p.Arg1947* NS 3 HLR
23 12 m yes c.5839C>T r.5839c>u p.Arg1947* NS 3 HLR
Tsipi et al. 144 [33] 12 f yes c.5839C>T r.5839c>u p.Arg1947* NS 3 HLR
Ulusal et al. 10 [34] 7 m yes c.5839C>T r.5839c>u p.Arg1947* NS 3 HLR
248 35 m no c.5839C>T r.5839c>u p.Arg1947* NS 3 HLR
159 17 m yes c.5851_5852insA r.(?) p.Thr1951Asnfs*5 FS 3 HLR
174 49 f no c.5890G>T r.(?) p.Glu1964* NS 3 HLR
114 23 m no c.5943G>T r.(?) p.Gln1891His MS 3 HLR
33 22 f no c.5944-1G>T r.5944_5950delauuacag p.Thr1983Lysfs*6 SS 3 HLR
Tsipi et al. 79 [33] 37 na no c.6110_6110delT r.(?) p.Ile2037Metfs*12 FS 3 HLR
Bonatti et al. 85 [37] na f yes c.6134delC r.(?) p.Thr2045Ilefs*4 FS 3 HLR
78 41 f no c.6278delG r.6278del p.Gly2093Valfs*36 FS 3 HLR
119 29 m no c.6346_6347insA r.(?) p.Ser2116Tyrfs*6 FS 3 HLR
4 42 m no c.6364+2T>A r.(?) p.(?) SS 3 HLR
201 12 f yes c.6365-2A>G r.6365_6579del p.Glu2122Glyfs*27 SS 3 HLR
Bonatti et al. 90 [37] na f yes c.6389_6393delTCAGTinsA r.(?) p.Leu2130Hisfs*2 FS 3 HLR
186 47 f no c.6477delC r.6477del p.Ser2160Valfs*19 FS 3 HLR
11 60 f no c.6641+1G>A r.6580_6641del p.Ala2194Ilefs*6 SS 3 HLR
239 24 f yes c.6641+1G>T r.6580_6641del p.Ala2194Ilefs*6 SS 3 HLR
Stella et al.1 [39] 2 f yes c.6687_6689delTGT r.(?) p.Val2230del ID 3 HLR
148 55 f no c.6688delG r.(?) p.Val2230Serfs*14 FS 3 HLR
80 8 f yes c.6709C>T r.6709c>u p.Arg2237* NS 3 HLR
86 43 m no c.6709C>T r.6709c>u p.Arg2237* NS 3 HLR
108 59 f no c.6709C>T r.6709c>u p.Arg2237* NS 3 HLR
249 71 m no c.6709C>T r.6709c>u p.Arg2237* NS 3 HLR
204 3 m yes c.6709C>T r.6709c>u p.Arg2237* NS 3 HLR
197 5 f yes c.6755A>G r.6642_6756del p.Phe2215Hisfs*6 SS 3 HLR
216 10 f no c.6756+11C>T r.6642_6756del p.Phe2215Hisfs*6 SS 3 HLR
210 12 f no c.6756+1G>T r.(?) p.(?) SS 3 HLR
198 3 m yes c.6770_6771insG r.6770_6771insg p.Cys2257Trpfs*6 FS 3 HLR
63 55 f yes c.6789_6792delTTAC r.(?) p.Tyr2264Glnfs*4 FS 3 HLR-CTD
194 28 m no c.6789_6792delTTAC r.(?) p.Tyr2264Glnfs*4 FS 3 HLR-CTD
Tsipi et al. 135 [33] 17 f yes c.6791_6792insA r.(?) p.Tyr2264* FS 3 HLR-CTD
20 45 f no c.6791_6792insA r.(?) p.Tyr2264* FS 3 HLR-CTD
53 29 m no c.6792C>A r.6757_6858del p.Ala2253_Lys 2286del SS 3 HLR-CTD
87 54 m no c.6792C>A r.6757_6858del p.Ala2253_Lys 2286del SS 3 HLR-CTD
184 9 f yes c.6792C>A r.6757_6858del p.Ala2253_Lys 2286del SS 3 HLR-CTD
12 42 m yes c.6834delC r.(?) p.Thr2279Asnfs*20 FS 3 HLR-CTD
185 4 f yes c.6858+3A>T r.6757_6858del p.Ala2253_Lys2286del SS 3 HLR-CTD
66 46 f no c.6999+1G>C r.(?) p.(?) SS 3 HLR-CTD
2 25 f no c.7096_7101delAACTTT r.7096_7101del p.Asn2366_Phe2367del ID 3 HLR-CTD
82 24 m yes c.7096_7101delAACTTT r.7096_7101del p.Asn2366_Phe2367del ID 3 HLR-CTD
69 22 m no c.7186_7188delCTA r.(?) p.Leu2396del ID 3 HLR-CTD
52 32 f yes c.7192_7193delCT r.(?) p.Leu2398Glyfs*2 FS 3 HLR-CTD
Tsipi et al. 128 [33] 5 m yes c.7285C>T r.(?) p.Arg2429* NS 3 CTD
252 54 m no c.7337C>A r.(?) p.Ser2446* NS 3 CTD
195 3 f yes c.7345_7346delAA r.7345_7346del p.Asn2449Cysfs*12 FS 3 CTD
225 12 m no c.7486C>T r.7486c>u p.Arg2496* NS 3 CTD
Calì et al. 76 [38] 12 f yes c.7486C>T r.7486c>u p.Arg2496* NS 3 CTD
218 12 f no c.7580_7581dupA r.(?) p.Ser2528Ilefs*7 FS 3 CTD
95 26 m no c.7619C>G r.(?) p.Ser2540* NS 3 CTD-NLS
Micaglio et al. [36] 23 m no c.7686delG r.(?) p.Ile2563fs*40 FS 3 CTD
229 11 m no c.7703delA r.(?) p.Gln2568Argfs*35 FS 3 CTD
19 10 m yes c.7720delA r.(?) p.Val2575Phefs*28 FS 3 CTD
Tsipi et al. 162 [33] 7 na yes c.7725_7726insG r.(?) p.Ser2576Valfs*4 FS 3 CTD
40 20 f no c.7806+1G>A r.(?) p.(?) SS 3 CTD
56 27 f no c.7993C>T r.7993c>u p.Gln2665* NS 3 CTD-SBR
141 20 m no c.8111delC r.(?) p.Pro2704Glnfs*14 FS 3 CTD-SBR
71 16 m yes c.8332G>A r.8332g>a p.Val2778Ile MS 3 CTD

ID code: simple numbers refer to the patients in our cohort; the patients retrieved from the literature are shown using the name of the first author and the code assigned in the original article; na = not available; nd = no domain; f = female; m = male. OPG, optic pathway glioma; CSRD, cysteine/serine-rich domain; TBD, tubulin-binding domain; GRD, GTPase activating protein-related domain; PH, pleckstrin homology-like domain; HLR, HEAT-like repeat regions; Sec-14, Sec14-like domain; CTD, C-terminal domain; NLS, nuclear localisation signal region; SBR, syndecan-binding region; NS, nonsense mutation; FS, frameshift mutation; MS, missense mutation; ID, inframe mutation; SS, splicing mutation; LD, large deletion.