Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Homo-sapiens) | HT1080-ST fibrosarcoma cell line | kind gift from J Lingner Cristofari and Lingner, 2006 | ||
| Cell line (Homo-sapiens) | TRF1 CRISPR/Cas9 HeLa cell line | kind gift from Z Songyang Kim et al., 2017 | Doxycycline-inducible | |
| Cell line (M. musculus) | TRF1F/F Mouse Embryonic Fibroblasts | Established in Boulton Lab (Crick Institute) Sfeir et al., 2009 | RRID:CVCL_UE12
Primary and SV40 immortalised |
|
| Transfected construct (human) - in HT1080-ST | TERF1 siRNA SMARTpool: ON-TARGETplus | Dharmacon/Thermo Fisher Scientific | #L-010542-02-0020 | 100 nM |
| Transfected construct (human) - in HT1080-ST | ctl siRNA ON-TARGETplus Non-targeting Pool | Dharmacon | #D-001810-10-20 | 100 nM |
| Other | Nucleofector II/2b Device | Lonza | #LO AAB-1001 | programme X-001. |
| Commercial assay, kit | Nucleofector kit T | Lonza | #VVCA-1002 | |
| Transfected construct (Mouse) | pLKO.1-puromycin lentiviral vectors shRNA for mouse SMC5 | Sigma | sequence: CCCATAATGCTCACGATTAAT | in MEFs |
| Transfected construct (Mouse) | pLKO.1-puromycin lentiviral vectors shRNA for mouse POLD3 | Sigma | Sequence: GCATATACTCATGTGTGGTTT |
in MEFs |
| Transfected construct (Mouse) | pLKO.1-puromycin lentiviral vectors GAPDH | Open biosystems | Sequence: CTCATTTCCTGGTATGACA | in MEFs |
| Software, algorithm | PRISM eight software, Statistical analysis | GraphPad | ||
| Chemical compound, drug | DAPI stain | Invitrogen | D1306 | (1 µg/mL) |
| Antibody | IgG, Rabbit polyclonal | Abcam | ab37415 | For ChIP 2 μg of antibody |
| Antibody | TRF2, Rabbit polyclonal | Novus | NB110−57130/B2 | For ChIP 5 μg of antibody |
| Antibody | BRCA1, Rabbit polyclonal | Novus | NBP1-45410 | For ChIP 5 μg of antibody |
| Antibody | BAZ1b, Rabbit polyclonal | Cell Signaling | 2152S | For ChIP 5 μg of antibody |
| Antibody | TR4, Mouse monoclonal | R and D biosystems | pp-H0107B-00 | For ChIP 5 μg of antibody |
| Antibody | P66a, Rabbit polyclonal | Novus | NBP1-87359 | For ChIP 5 μg of antibody |
| Antibody | MTA1, Rabbit polyclonal | Abcam | ab71153 | For ChIP 5 μg of antibody |
| Antibody | CHD4, Rabbit polyclonal | Novus | NB100-57521 | For ChIP 5 μg of antibody |
| Antibody | ZNF827, Mouse monoclonal | Santa Cruz | sc514943 | For ChIP 5 μg of antibody |
| Antibody | IgG, Rabbit polyclonal | Abcam | ab37415 | For IF (1:1000) |
| Antibody | TRF2, Rabbit polyclonal | Novus | NB110−57130/B2 | For WB (1:1000) and IF (1:250) |
| Antibody | TRF2, Rabbit polyclonal | Gift from T de Lange | Ref: 1254 | For WB (1:1000) and IF (1:250) |
| Antibody | TRF1, Rabbit polyclonal | Gift from T de Lange | Ref: 1449 | For WB (1:1000) and IF (1:250) |
| Antibody | PML, Rabbit polyclonal | Gift from Paul Freemont | / | For IF (1:250) |
| Antibody | SMC5, Rabbit polyclonal | Gift from Jo Murray | / | For WB (1:1000) and IF (1:250) |
| Antibody | Beta-actin, Mouse monoclonal | Abcam | ab8226 | For WB (1:5000) |
| Antibody | BrdU, Mouse monoclonal | MBL | MI-11–3 | For IF (1:500) |
| Antibody | Anti-rabbit Alexa 488 antibody, Donkey polyclonal | Thermo, | A21206 | For IF (1:2000) |
| Antibody | Anti-mouse Ig-HRP, Goat polyclonal | DAKO | P0447 | For WB (1:5000) |
| Antibody | Anti-Rabbit Ig-HRP, Pig polyclonal | DAKO | P0217 | For WB (1:10000) |