TABLE 2.
Characterization of the calcineurin bypass mutants isolated in the cnaBΔ mutant background
| Strain | Genotype in the bycA allele | Remark | Type of mutation |
|---|---|---|---|
| CSR1 | C1240del | Frameshift | |
| CSR2 | Potential deletion | No bycA PCR product | |
| CSR3 | 733 C→A | Missense | |
| CSR4 | 633delG | Whole genome sequenced | Frameshift |
| CSR5 | 407C→T | Whole genome sequenced | Missense |
| CSR6 | 2188delC | Whole genome sequenced | Frameshift |
| CSR7 | 806_825delCCTACCCGCCAGTGGAAGCA | Frameshift | |
| CSR8 | 1711delG | Frameshift | |
| CSR9 | 2188delC | Whole genome sequenced | Frameshift |
| CSR10 | 1649delT | Whole genome sequenced | Frameshift |
| CSR11 | 578G→A | Nonsense | |
| CSR12 | 621delT | Frameshift | |
| CSR13 | 2296_2297insAAT | Frameshift | |
| CSR14 | 218G→A | Nonsense | |
| CSR16 | 2263delC | Whole genome sequenced | Frameshift |
| CSR28 | 215G→A | Missense | |
| CSR29 | No mutation in bycA allele | ||
| CSR35 | No mutation in bycA allele | ||
| CSR38 | No mutation in bycA allele |