Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer sequences used in PCR assays
| SOX9 | Forward | gcgacgtcatctccaacatc |
| Reverse | tggtcggtgtagtcgtactg | |
| ACAN | Forward | tccccaacagatgcttccat |
| Reverse | gaacatcattccactcgccc | |
| COL1A1 | Forward | caggctggtgtgatgggatt |
| Reverse | aaacctctctcgcctcttgc | |
| COL2A1 | Forward | cttaggcccgagagaagg |
| Reverse | gcgtaggaggtcatctgga |
