Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used in this study
| Primer | Oligonucleotide sequence (5′–3′) | Temperature (°C) | Product (bp) | Reference |
|---|---|---|---|---|
| fus-F | CTTTAACAGAAGATGAAGCTG | 61 | 540 | This study |
| fus-R | CTAAGGCAGATATTCTTCTC | 61 | 540 | This study |
| fadA-F | CAC AAG CTG ACG CTG CTA GA | 61 | 232 | [18] |
| fadA-R | TTACCAGCTCTTAAAGCTTG | 61 | 232 | [18] |
F and R represent forward and reverse primers.
