Table 1.
Sequence of aptamer and oligonucleotide linkers L1 and L2
| Name | Sequences (5′ → 3′) |
|---|---|
| Apt | ACCACCACCCGCATGCCAAACGTTGCCTCATAGTTCCCTCCCCGTGTCCTTCTTCTTC |
| L1 | GGTGGTGGT‐ C6 Amine |
| L2 | Thiol‐GAAGAAGAA |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.