Skip to main content
PLOS One logoLink to PLOS One
. 2020 Feb 4;15(2):e0226668. doi: 10.1371/journal.pone.0226668

Reference gene selection for quantitative real-time PCR (qRT-PCR) expression analysis in Galium aparine L.

Xu Su 1,#, Liuyang Lu 1,#, Yashe Li 1, Congai Zhen 2, Guilei Hu 1, Kun Jiang 1, Yawei Yan 1, Yanbo Xu 1, Geng Wang 1, Mingwang Shi 1, Xiling Chen 1, Baizhong Zhang 1,*
Editor: Ilker Buyuk3
PMCID: PMC6999859  PMID: 32017769

Abstract

To accurately evaluate expression levels of target genes, stable internal reference genes is required for normalization of quantitative real-time PCR (qRT-PCR) data. However, there have been no systematical investigation on the stability of reference genes used in the bedstraw weed, Galium aparine L. (BGA). In this study, the expression profiles of seven traditionally used reference genes, namely 18S, 28S, ACT, GAPDH, EF1α, RPL7 and TBP in BGA were assessed under both biotic (developmental time and tissue), and abiotic (temperature, regions and herbicide) conditions. Four analytical algorithms (geNorm, Normfinder, BestKeeper and the ΔCt method) were used to analyze the suitability of these genes as internal reference genes. RefFinder, a comprehensive analytical software, was used to rank the overall stability of the candidate genes. The optimal normalization internal control genes were ranked as: 28S and RPL7 were best for all the different experimental conditions (developmental stages, tissues, temperature, regions and herbicide treatment); 28S and RPL7 for developmental stages; TBP and GAPDH for different tissues; 28S and GAPDH were relatively stable for different temperature; 28S and TBP were suitable for herbicide treatment. A specific set of reference genes were recommended for each experimental condition in BGA.

Introduction

Quantitative Real-time PCR (qRT-PCR) is considered as the most common method for gene expression quantification, due to high sensitivity and efficiency[13]. However, the accuracy of qRT-PCR can be influenced by the quality of the template, the efficiency of transcription and amplifcation, and experimental procedures between samples[4]. To enhance the accuracy of qRT-PCR analysis, several strategies such as normalization of sample size, ensurence of the RNA quality and quantity, and removal of DNA contamination were carried out [5]. Among these strategies, normalization of gene expression is essential to prevent nonbiological alteration or incorrection, and the currently preferred practice is to determine the target gene expression with an internal reference gene as control[1, 6]. No reference gene exhibits stable expression under all conditions. Therefore, it is essential to select stable reference genes for determining the transcript changes of target gene by qRT-PCR. Besides, it is integral to estimate suitable reference genes for each specific condition. Several algorithms, such as geNorm[7], BestKeeper[8], and NormFinder[9]were used for candidate reference genes evaluation. The frequently used housekeeping genes, such as β-actin (ACT), α-tubulin (TUA), ubiquitin (UBQ), cyclophilin (CYP), glyceraldehde-3-phosphate dehydrogense (GAPDH), 18S or 28S ribosomal RNA and elongation factors (EF) have been verified to be suitable as internal control genes in many plants[1012].

Bedstraw weed, Galium aparine L. (BGA), a malignant weed from the Rubiaceae family, can cause great harm to oilseed rape, wheat and some other crops in China[13]. The control of this weed normally relies on chemical herbicides for decades. However, the wide, unreasonable and dominant application of chemical herbicides not only caused cropland deterioration, but also caused rapid development of weed resistance to chemical herbicides[14]. Resistance mechanisms usually included target-site resistance (TSR) and/or non-target site resistance (NTSR) mechanisms. Both the over-expression of target proteins and structural changes to the herbicide-binding sites belonged to TSR mechanisms. Hence, it was necessary to select the suitable reference genes for evaluation the target gene expression in weed species. To date, the expression levels of reference genes have been commonly quantified in various weeds by qRT-PCR[15,16]. Only one reference gene such as 18S, GAPDH, or ACT was selected for normalization the target gene expression by qRT-PCR under all the diverse experimental conditions in multiple studies. However, it is indispensable to use at least 2 or 3 reference genes for achieving accurate normalization[7,17].

Reference gene validation in weeds is lacking of systematization and should be paid more attention, especially in agricultural weeds. Hence, it is important to assess stable reference genes in BGA for qRT-PCR quantification. Seven common reference genes, such as 18S, 28S, ACT, GAPDH, EF1α, RPL7 and TBP, were selected and evaluated for target gene expression normalization using the qRT-PCR method in BGA. Our results revealed that specific reference genes were required for qRT-PCR normalization under various experimental conditions.

Materials and methods

Cultivation of seedlings

The seeds of BGA used in this study were collected from a Xinxiang county wheat field (35°18'13.71''N, E113°55'15.05''E) in Henan Province, China, in Year 2010. The wheat field belonged to our college and collection was permitted by our college. Cultivation of BGA was adopted by the greenhouse potting methods[18]. The seeds of BGA were sown into 75 cm2 pots filled with a mixture of soil sand and grass biochar, and germinated in the greenhouse under 20 / 15 °C day/night temperatures with a 12 /12 h (light /dark) cycle and 75±5% relative humidity.

Biotic conditions

BGA foliar parts were obtained with specific developmental stage including 1-leaf stage, 2-leaves stage, and 3-leaves stage. Different vegetative tissue including leaves, roots, and stems were seperately collected. Ten individual plants was randomly selected per repetition and three biological replicates were used in this study. After collection, all samples were rapidly frozen in liquid nitrogen and stored at -80 °C for subsequent total RNA isolation and qRT-PCR testing.

Abiotic conditions

To examine the effect of herbicide, the concentration of herbicide tribenuron-methly was determined as 10 g ai/ha (IC10) by a modified whole-plant assay[19]. 3-leaves stage BGA plants with height about 20 cm were exposed to tribenuron-methly at the corresponding IC10 concentration with an auto spray device (ASP-1098) under 0.2 MPa pressure. The liquid volume was 450 L each ha. Water alone was selected as control. Foliar parts were collected after 24 h treatment, quickly frozen with liquid nitrogen before storage at −80 °C.

Selection of reference gene and primer design

To identify suitable reference genes for qRT-PCR analysis in BGA, seven common reference genes, such as 18S ribosomal RNA (18S rRNA), 28S rRNA (28S), actin (ACT), elongation factor 1 alpha (EF1α), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal protein L7 (RPL7), and TATA box binding protein-associated factor (TBP), were selected for qRT-PCR analysis. The primers used for qRT-PCR were designed with the Primer3.0 software. The corresponding primer information were listed in Table 1. Besides, the detailed sequences of the seven selected reference genes were shown in S1 File.

Table 1. Primer information of candidate reference genes and a target gene.

Gene Symbol Gene name Tm (°C) Sequence (5´–3´) Product Length (bp)
ACT Actin 57.45 F: GGACCGGTTGAGTTCGAGAA 111
55.40 R: ACTACGGCCAACCTTGTCAA
18S 18s ribosomal 57.45 F: GCAGTCTCCATCAACCCACT 106
57.45 R: CTTCACCGCTAACATCACGC
28S 28s ribosomal 55.40 F: TTGTCCGCATCAAAACTGGG 98
55.40 R: AACGACTATTCCGGCACTCT
GAPDH Glyceraldehyde-3-phosphate 55.40 F: GCCCATTTTCAGCTGCAAAC 117
55.40 R:TTTGCAGCCAACTTCTTCCC
EF1α Elongation factor 1 alpha 57.45 F:TCTGACCGTCCTTGGAGATG 93
57.45 R: TGATCACCGGAACCTCTCAG
TBP TATA box binding protein 57.45 F: TTGGGTGTTACTGTGGAGGC 112
57.45 R: CAGTGGCTGGAATGGAAGGA
RPL7 Ribosomal protein L7 55.40 F: AAGACGAAGGAGCTGCAGAA 106
55.40 R:CAACTTCTATGTGCCCGCAG
HSP70 Heat shock protein 70 58.98 F: ACCTGCACCTGATGTCGTTA 105
58.93 R: GGTGCTGCTTCCTTCTTCTG

Notes: F, forward primer; R, reverse primer; Tm, melting temperature; R2, coefficient of determination

Total RNA extraction and cDNA synthesis

Total RNA was isolated using TRIzol (Invitrogen, USA) according to the manufacturer’s recommendations. The RNA integrity was determined by electrophoresis with 1% agarose gel. The quality and quantity of RNA were measured using a NanoDrop 2000 UV-Vis spectrophotometer (Thermo Fisher Scientific Inc., USA). Each sample of 1 μg RNA was reverse transcribed using PrimeScript RT reagent Kit with gDNA Eraser (Perfect Real Time) (TaKaRa, Japan) following the manufacturer’s instructions in a total volume of 20 μl. The cDNA templates were stored at -20°C until use in qRT-PCR.

Quantitative real-time PCR (qRT-PCR)

qRT-PCR was implemented in a 7500 Real-Time PCR system (Applied Biosystems, USA). Each reaction (20 μl) contained 1 μl of cDNA template, 10 μl of SYBR Green qRT-PCR SuperMix-UDG (Invitrogen, USA), 0.3 μl of each specifc primer, and 8.7 μl of nuclease-free water. No cDNA template but corresponding volume nuclease-free water was used as NTC.

The amplification conditions for qRT-PCR were set as follows: 50°C for 2 min, 95°C for 2 min, and 40 cycles of 95°C for 15 s, and 55°C for 30 s. For melting curve analysis, a dissociation step cycle (from 65 to 95 °C) was carried out to verify the gene-specific amplifcation. Relative standard curves for the transcripts were conducted with a 5-fold dilution series of cDNA. The corresponding qRT-PCR efficiencies (E) were calculated using the equation: E = (10−1/slope-1)×100% [2022]. All opperations were processed with three biological replications and at least two technical replications.

Constancy analysis of reference gene expression

The stability of the seven candidate reference genes was assessed using the comparative ΔCt method[23], geNorm[7], NormFinder[9], and BestKeeper[8]. RefFinder, one free available online software was also applied to further estimate the stability of reference genes with the advantage of integrating the above all four major computational programs.

The geNorm program provides a calculation of gene expression stability value (M), and the reference gene with the lowest M value is considered as the most stable gene. In general, the candidate reference gene is considered stable when an M value below 1.5. The geNorm also performs a pairwise variation (V) with a serial ratio of Vn/n+1. Addition of another reference gene could be required for accurate normalization when a Vn/n+1 value above 0.15. NormFinder software calculates the expression stability of the candidate reference gene in all given sample set and ranks the stability order of candidate genes[9]. BestKeeper considers the Ct values of all the selected reference genes to determine the standard deviation for screening the “optimal” reference genes. The ΔCT method directly make a relative expression comparison between two candidate genes within the same sample. RefFinder combines the above four methods and gives the overall final ranking order.

Validation of selected reference gene

One heat shock gene (HSP70) was regarded as the target gene to validate the reference genes stability. HSP70 expression levels under diverse factors were assessed according to different candidate reference genes as the internal control genes. Normalization factors (NFs) were computed based on the geometric mean values which was determined by RefFinder. The expression profiles of HSP70 in different treatment were conducted with the 2–ΔΔCT method[20].

Statistical analysis

Statistical analysis were performed with the software InStat v.3.0 (GraphPad Software, San Diego, CA). One-way ANOVA test was chosen for different comparison of target gene expression with significance P < 0.05.

Results and discussion

Evaluation of reference genes expression stability

All the primer pairs of seven selected candidate reference genes and one target gene (HSP70) was specific through evaluation by PCR. For each candidate reference gene, a single PCR product band with the expected size was visualized by 1.5% agarose gel. Besides, gene-unique amplification was also corroborated by a single qRT-PCR melting curve peak. Standard curve analysis revealed that the amplification efficiency of qRT-PCR varied from 90.5 to 105.3% (Table 1). Besides, the linear regression correlation coefcients (R2) of all the 8 genes ranged from 0.983 to 0.998 (Table 1).

The mean Ct values of all the tested reference genes were between 27.24 (ACT) to 31.21(18S), covering all the experimental conditions (Fig 1). Among the candidate genes, ACT was the most accumulated transcripts, indicated by the lowest mean Ct value of 27.24, whereas 18S had the lowest transcript expression level with a mean Ct value of 31.21.

Fig 1. Expression levels of candidate reference genes of Galium aparine.

Fig 1

The mean Ct values of candidate reference genes in all tested samples were indicated by the black dot, while the standard deviation of the mean was represented by the bars.

For tissue samples, the rankings of reference gene stability were similar based on ΔCt method and Normfinder, showing TBP and RPL7 as the top two most stable genes. While, TBP was considered as the most stable gene using BestKeeper and geNorm (Table 2). RefFinder produced the stability rankings from most stable to least as TBP, GAPDH, 28S, RPL7, 18S, EF1α and ACT (Fig 2A). GeNorm indicated that the gene number would be suitable for normalization. In comparison with the cut-off value of 0.15, the V3/4, V5/6, and V6/7 values were exceeded (Fig 3), indicating that additional reference genes are required.

Table 2. Expression stability of the candidate reference genes in response to different conditions.

Conditions ΔCt BestKeeper Normfinder geNorm
Stability Rank Stability Rank Stability Rank Stability Rank
Different tissues ACT 2.455 7 2.462 7 2.138 7 1.946 7
18S 2.185 5 1.288 5 1.776 5 1.426 5
28S 1.942 4 0.636 3 1.469 4 1.023 3
GAPDH 1.705 3 0.565 2 1.081 3 0.696 1
EF1α 2.253 6 2.068 6 1.840 6 1.745 6
TBP 1.525 1 0.403 1 0.644 2 0.696 1
RPL7 1.570 2 1.181 4 0.352 1 1.148 3
Developmental sages ACT 2.183 7 1.402 7 2.085 7 1.429 7
18S 1.420 5 1.170 6 1.058 5 0.858 3
28S 1.250 3 0.758 4 0.763 4 0.604 1
GAPDH 1.325 4 0.397 1 0.759 3 1.128 6
EF1α 1.215 2 0.538 2 0.435 1 1.049 5
TBP 1.173 1 0.725 3 0.570 2 0.738 2
RPL7 1.438 6 1.091 5 1.185 6 0.604 1
Herbicide treatments ACT 2.234 6 1.235 4 1.224 5 1.022 6
18S 2.226 5 1.641 6 1.656 6 0.864 5
28S 1.701 2 0.863 2 0.075 1 0.150 1
GAPDH 1.990 4 0.610 1 0.376 3 0.723 3
EF1α 6.638 7 4.652 7 6.605 7 2.626 7
TBP 1.691 1 0.867 3 0.075 2 0.150 1
RPL7 1.904 3 1.383 5 1.055 4 0.513 2
Temperature ACT 2.660 7 2.284 7 2.476 7 1.779 7
18S 1.406 1 0.906 2 0.529 1 0.986 3
28S 1.432 2 1.480 5 0.566 2 0.460 1
GAPDH 1.560 4 1.529 6 0.978 4 0.460 1
EF1α 2.041 6 0.701 1 1.657 6 1.427 6
TBP 1.522 3 1.299 4 0.886 3 0.791 2
RPL7 1.836 5 0.931 3 1.453 5 1.210 5
Region ACT 1.476 5 1.410 7 1.123 5 1.084 4
18S 1.338 4 1.133 5 1.011 4 0.633 1
28S 1.250 3 1.165 6 0.837 3 0.701 2
GAPDH 1.740 7 0.977 4 1.498 7 1.374 7
EF1α 1.494 6 0.869 1 1.132 6 1.228 6
TBP 1.145 1 0.876 2 0.622 2 0.633 1
RPL7 1.176 2 0.912 3 0.563 1 0.830 3
Pooled samples ACT 2.941 6 2.033 6 2.611 6 1.585 6
18S 1.946 2 1.316 3 1.313 2 0.864 3
28S 2.382 4 1.910 5 1.985 4 1.126 4
GAPDH 1.952 3 1.150 2 1.356 3 0.661 2
EF1α 3.523 7 1.729 4 3,286 7 1.883 7
TBP 1.689 1 1.129 1 0.889 1 0.389 1
RPL7 2.543 5 2.115 7 2.194 5 1.329 5

Fig 2. Expression stability of the candidate reference genes in response to different conditions.

Fig 2

The average expression stability of the reference genes as calculated using geNorm. A lower Geomean of ranking value indicates more stable expression. (A) Tissues, (B) Development stage, (C) Temperature, (D) Regions, (E) Herbicide treatments, (F) Pooled samples.

Fig 3. Optimal number of reference genes for normalization in Galium aparine.

Fig 3

The normalization factors (NFn and NFn+1) was employed to analyze pair-wise variation (Vn/n+1), then it can determine the optimal number of reference genes required for accurate normalization in a given set of experiment. A value < 0.15 indicates that the use of additional reference genes would not markedly improve normalization.

For diferent developmental stages, the stability rankings were almost the same using ΔCt method and NormFinder with TBP and EF1α as the top two most stable candidate reference genes. GeNorm analysis identified 28S and EF1α as the most and the least stable reference genes, respectively. GAPDH and EF1α were demonstrated as the top two most stable reference genes by Bestkeeper (Table 2). Integrating the results from all four programs, RefFinder provided a ranking as 28S, RPL7, TBP, 18S, EF1α, GAPDH and ACT (Fig 2B) across different developmental stages. In comparison with the cut-off value of 0.15, the pair-wise value of V6/7 was above 0.15 (Fig 3), suggesting the number of reference genes should be added for accurate normalization.

For three different regions, the top two most stable reference genes were identified as TBP and RPL7 by the ΔCt method and NormFinder, respectively. Analysis using BestKeeper showed that the most stable reference gene for normalization was EF1α. According to RefFinder, the ranking of seven selected reference genes from the highest to lowest stability) was: TBP, 18S, 28S, RPL7, ACT, EF1α, and GAPDH. GeNorm showed that all the pair-wise values of Vn/n+1 were below 0.15 across different regions including Xinxiang, Kaifeng, and Luohe (Fig 3).

For different temperatures, the ΔCt method and NormFinder results exhibited that 18S and ACT were considered as the most stable and the least reference gene, respectively. GeNorm results revealed that 28S and GAPDH were the top two most stable reference genes. The expression stability of the seven reference genes from the most to the least stable was comprehensively ranked as 28S, GAPDH, TBP, 18S, RPL7, EF1α and ACT based on RefFinder (Fig 2C). From geNorm analysis, the Vn/n+1 values were all below 0.15 across different temperatures (Fig 3), indicating no supplemental reference gene was added for normalization of the qRT-PCR analyses. Thus, 28S and GAPDH were the most suitable candidate reference genes across different temperatures.

For three different regions, the top two most stable reference genes were identified as TBP and RPL7 by the ΔCt method and NormFinder, respectively. Analysis using BestKeeper showed that the most stable reference gene for normalization was EF1α. According to RefFinder, the ranking of seven selected reference genes from the highest to lowest stability) was: TBP, 18S, 28S, RPL7, ACT, EF1α, and GAPDH (Fig 2D). GeNorm showed that all the pair-wise values of Vn/n+1 were below 0.15 across different regions including Xinxiang, Kaifeng, and Luohe (Fig 3).

For herbicide application, the most stable reference gene was TBP based on ΔCt method and geNorm. TBP and 28S were the top two ranked genes by geNorm (Table 2). However, EF1α was the least stably expressed reference gene by employing all the four different algorithms. Based on RefFinder, the order of reference gene stability ranking across herbicide application was: 28S, TBP, RPL7, GAPDH, 18S, ACT and EF1α (Fig 2E). GeNorm showed that the Vn/n+1 values were all below 0.15 across herbicide application (Fig 3), indicating supplemental reference gene was unnecessary. Therefore, 28S and TBP were considered the top two suitable reference genes across herbicide stress.

For all the experimental conditions, the ranking order of reference gene stability was the same according to Ct method and NormFinder, and TBP and EF1α were confirmed as the most stable and the least stable one, respectively. Furthermore, ACT was confirmed as the less unstable reference gene by all of them (Table 2). Based on RefFinder, the stability ranking order of reference gene across various conditions was: TBP, GADPH, 18S, 28S, RPL7, ACT, and EF1α (Fig 2F). All pairwise variations with the Vn/n+1 values were evaluated using GeNorm across diverse conditions (Fig 3). Therefore, 28S and RPL7 were determined to be the best housekeeping genes under various conditions.

qRT-PCR has been broadly used for quantification of the gene transcript abundance. The accurate and reliable qRT-PCR results were always affected by diverse factors including RNA quality, cDNA synthesis, experimental procedures, and reference gene normalization. Therefore, reliable reference gene selection is of particular importance for successful qRT-PCR analysis. To date, no study have systematically been focused on evaluation of the reference gene stability in BGA.

Our results indicated that 28S and RPL7 were the top two most stable reference genes across various experimental conditions according to RefFinder analysis and four diferent algorithms including ΔCt method, geNorm, BestKeeper, and Normfinder. The ranking order of reference gene stability can vary due to different algorithms with the four analytical tools. With the integration the four statistical methods, RefFinder, a comprehensive web-based tool, was chosen to rank the overall stability of the seven candidate reference genes. In this study, 28S and RPL7 were considered as the top two most stable reference genes using RefFinder within specific condition. However, GAPDH, ACT and EF1α were identified as the unstable reference genes across development stages, tissues, temperatures, regions, and herbicide treatments, sexes. Similarly, 18S r RNA or 28S was identified as the most stable reference gene in rice[24], the Australian sheep blowfly[25], and eggplant[26]. In contrast, GAPDH was reported as one of the most stably expressed genes in weed species Lolium sp.[27] and Avena fatua[28]. GAPDH was also identified unstable in Petunia hybrida across development stage[29]. EF1α was considered to be the reliable reference gene under given experimental conditions in current study, and this is the same as results of some insects such as bumblebee[30] and cotton bollworm[31].

Liu et al.[28] evaluated TBP as the best reference gene in Avena fatua, and TBP was also identified as an ideal reference gene in tomato [32] and annual ryegrass[33]. Our results demonstrated that traditional reference gene ACT, involved in cytoskeleton structure, was not usually unchange under diverse experimental treatments. Similar findings were verified in the beetle Tribolium castaneum[34], perigord black truffle[35] and Avena fatua[36]. Therefore, no reference genes in multiple species show unchanged expression across all the tested conditions[37,38], suggesting that it is of particular important to identify suitable reference genes in BGA.

Validation of selected reference genes

To validate the recommended reference genes in this study, the relative expression level of one target gene, HSP70, was analyzed under all the experimental conditions. For different regions of BGA, the relative expression level of HSP70 was significantly up-regulated in Luohe and Kaifeng than in Xinxiang when using the most stable reference gene (NF1: TBP), the recommended normalization combination (NF1–2:TBP and 18S), and the least stable reference gene (NF7: GAPDH), significant difference was found in HSP70 expression when using single reference gene (the most stable, TBP) or reference gene combination (NF1–2: TBP and 18S) and single reference gene (the least stable, GAPDH) (Fig 4A).

Fig 4. Expression patterns of HSP70 using different normalization factors.

Fig 4

(A) in different regions. (B) in different temperatures. (C) under herbicide treatments. Bars represent the mean ± standard deviation of 3 biological replicates.

For BGA exposed to different temperatures, the relative expression level of HSP70 expression was significantly higher at 25°C or 35°C than at 15°C. The relative expression levels of HSP70 increased less at 35°C using the least stable reference gene (ACT) in comparison with the most stable one (28S) and the recommended normalization factors (GAPDH and 28S) as normalization (Fig 4B). Normalized by stable reference gene, the combination of the two most stable reference genes or the least stable reference gene, significant difference was found in HSP70 expression when treated with herbicide when using single reference gene (the most 28S) or reference gene combination (28S and TBP) and and single reference gene (the least EF1α). Meanwhile, HSP70 was significantly up-regulated under the herbicide stress in comparison with the control groups. The expression level of HSP70 was significantly increased by normalization with the least stable reference gene (28S) than by the most stable reference gene (GAPDH) and the recommended combination (ACT and GAPDH) (Fig 4C).

HSP70, an important stress-inducible heat shock protein gene, is as a target gene to validate its relative expression using the most stably expressed reference gene, the most unstably expressed one, and the recommended combination. The qRT-PCR analyzed results indicated that the transcriptional levels of target gene HSP70 varied significantly with normalization of different reference gene. This study represents the first attempt to select a set of candidate reference genes in BGA under various conditions for the normalization of gene expression data using qRT-PCR. 28S and RPL7 were identified as the most stably expressed reference genes under all experimental conditions, which provided a standardized procedure for the quantifcation of gene expression in BGA.

Supporting information

S1 File. Sequences of reference and target genes tested in Galium aparine.

(XLS)

Data Availability

All relevant data are within the paper and its Supporting Information file.

Funding Statement

This work is supported by the National Key Research and Development Program of China (2017YFD0201700) to XC, the Key Science and Technology Program of Henan (Agriculture) (182102110053) to BZ, and Project of Plant Protection Key Discipline of Henan Province (1070202190011005). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Liang P, Guo Y, Zhou X, Gao XW. Expression profiling in, Bemisia tabaci, under insecticide treatment: indicating the necessity for custom reference gene selection. Plos One. 2014; 9: e87514 10.1371/journal.pone.0087514 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Lu Y, Yuan M, Gao X, Kang TH, Zhan S, Wan H, et al. Identification and validation of reference genes for gene expression analysis using quantitative PCR in Spodoptera litura (Lepidoptera: Noctuidae). PloS One. 2013; 8: e68059 10.1371/journal.pone.0068059 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Overbergh L, Giulietti A, Valckx D, Decallonne B, Bouillon R, Mathieu C. The use of real-time reverse transcriptase PCR for the quantification of cytokine gene expression. J Biomol Tech. 2003; 14: 33–43. [PMC free article] [PubMed] [Google Scholar]
  • 4.Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, et al. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 2009; 55: 611–622. 10.1373/clinchem.2008.112797 [DOI] [PubMed] [Google Scholar]
  • 5.Huggett J, Dheda K, Bustin S, Zumla A. Real-time RT-PCR normalisation; strategies and considerations. Genes Immun. 2005; 6: 279 10.1038/sj.gene.6364190 [DOI] [PubMed] [Google Scholar]
  • 6.Ciric L. Real-time PCR: Current technology and applications. Acb News. 2010; 568: 6. [Google Scholar]
  • 7.Vandesompele J, de Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, et al. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol Res. 2002; 3: 34.1–36.11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Pfaffl MW, Tichopad A, Prgomet C, Neuvians TP. Determination of stable reference genes, differentially regulated target genes and sample integrity: BestKeeper—Excel-based tool using pair-wise correlations. Biotechnol Lett. 2004; 26: 509–515. 10.1023/b:bile.0000019559.84305.47 [DOI] [PubMed] [Google Scholar]
  • 9.Andersen CL, Jensen JL, Ørntoft TF. Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 2004; 64: 5245–5250. 10.1158/0008-5472.CAN-04-0496 [DOI] [PubMed] [Google Scholar]
  • 10.Maroufi A, Bockstaele EV, Loose MD. Validation of reference genes for gene expression analysis in chicory (Cichorium intybus) using quantitative real-time PCR. BMC Mol Biol. 2010; 11: 15–27. 10.1186/1471-2199-11-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Nicot N, Hausman JF, Hoffmann L, Evers D. Housekeeping gene selection for real-time RT-PCR normalization in potato during biotic and abiotic stress. J Exp Bot. 2005; 56: 2907–2914. 10.1093/jxb/eri285 [DOI] [PubMed] [Google Scholar]
  • 12.Garg R, Sahoo A, Tyagi AK, Jain M. Validation of internal control genes for quantitative gene expression studies in chickpea. Biochem Biophys Res Commun. 2010; 396: 283–288. 10.1016/j.bbrc.2010.04.079 [DOI] [PubMed] [Google Scholar]
  • 13.Deng W, Di Y, Cai J, Chen Y. Target-site resistance mechanisms to tribenuron-methyl and cross-resistance patterns to ALS-inhibiting herbicides of catchweed bedstraw (Galium aparine) with different ALS mutations. Weed Sci. 2019; 67: 183–188. [Google Scholar]
  • 14.Sun J, Wang J, Zhang H, Liu J, Bian S. Study on mutations in als of resistance to tribenuron-methyl in Galium aparine L. Sci Agr Sin. 2010; 43: 972–977. [Google Scholar]
  • 15.Cruzhipolito H, Osuna MD, Domínguezvalenzuela JA, Espinoza N, De Prado R. Mechanism of resistance to accase-inhibiting herbicides in Wild Oat (Avena fatua) from Latin America. J Agr Food Chem. 2011; 59: 7261–7267. [DOI] [PubMed] [Google Scholar]
  • 16.Chatham LA, Bradley KW, Kruger GR, Martin JR, Owen MD, Peterson DE, et al. A multistate study of the association between glyphosate resistance and EPSPS gene amplification in waterhemp (Amaranthus tuberculatus). Weed Sci. 2015; 63: 569–577. [Google Scholar]
  • 17.Thellin O, Zorzi W, Lakaye B, De Borman B, Coumans B, Hennen G, et al. Reference genes as internal standards: use and limits. J Biotechnol. 1999; 75: 291–295. [DOI] [PubMed] [Google Scholar]
  • 18.Li R, Zhang J, Chen G. Advance of study on identification of weed herbicide resistance. Chinese Agr Sci Bull. 2010; 26: 289–292. [Google Scholar]
  • 19.Ryan GF. Resistance of common groundsel to simazine and atrazine. Weed Sci. 1970; 18: 614–616. [Google Scholar]
  • 20.Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001; 29: e45 10.1093/nar/29.9.e45 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Radonic A, Thulke S, Mackay IM, Landt O, Siegert W, Nitsche A. Guideline to reference gene selection for quantitative real-time PCR. Biochem Bioph Res Co. 2004; 313: 856–862. [DOI] [PubMed] [Google Scholar]
  • 22.Spiess AN, Rödiger S, Burdukiewicz M, Volksdorf T, Tellinghuisen J. System-specific periodicity in quantitative real-time polymerase chain reaction data questions threshold-based quantitation. Sci Rep. 2016; 6: 38951 10.1038/srep38951 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Silver N, Best S, Jiang J, Thein SL. Selection of housekeeping genes for gene expression studies in human reticulocytes using real-time PCR. BMC Mol Biol. 2006; 7: 33 10.1186/1471-2199-7-33 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Kim BR, Nam HY, Kim SU, Kim SI, Chang YJ. Normalization of reverse transcription quantitative-PCR with reference genes in rice. Biotechnol Lett. 2003; 25: 1869–1872. 10.1023/a:1026298032009 [DOI] [PubMed] [Google Scholar]
  • 25.Bagnall NH, Kotze AC. Evaluation of reference genes for real-time PCR quantification of gene expression in the Australian sheep blowfly, Lucilia cuprina. Med Vet Entomol. 2010; 24: 176–181. 10.1111/j.1365-2915.2010.00866.x [DOI] [PubMed] [Google Scholar]
  • 26.Gantasala NP, Papolu PK, Thakur PK, Kamaraju D, Sreevathsa R, Rao U. Selection and validation of reference genes for quantitative gene expression studies by real-time PCR in eggplant (Solanum melongena L). BMC Res Notes. 2013; 6: 1–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Duhoux A, Délye C. Reference genes to study herbicide stress response in Lolium sp.: up-regulation of P450 genes in plants resistant to acetolactate-synthase inhibitors. PLos One. 2013; 8: e63576 10.1371/journal.pone.0063576 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Liu J, Li P, Lu L, Xie L, Chen X, Zhang B. Selection and evaluation of potential reference genes for gene expression analysis in Avena fatua. Plant Prot Sci. 2018; 55: 61–71. [Google Scholar]
  • 29.Mallona I, Lischewski S, Weiss J, Hause B, Egea-Cortines M. Validation of reference genes for quantitative real-time PCR during leaf and flower development in Petunia hybrida. BMC Plant Biol. 2010; 10: 4 10.1186/1471-2229-10-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Hornáková D, Matousková P, Kindl J, Valterová I, Pichová I. Selection of reference genes for real-time polymerase chain reaction analysis in tissues from Bombus terrestris and Bombus lucorum of different ages. Anal Biochem. 2010; 397: 118–120. 10.1016/j.ab.2009.09.019 [DOI] [PubMed] [Google Scholar]
  • 31.Zhang S, An S, Li Z, Wu F, Yang Q, Liu Y, et al. Identification and validation of reference genes for normalization of gene expression analysis using qRT-PCR in Helicoverpa armigera, (Lepidoptera: Noctuidae). Gene. 2015; 555: 393–402. 10.1016/j.gene.2014.11.038 [DOI] [PubMed] [Google Scholar]
  • 32.Expósito-Rodríguez M, Borges AA, Borges-Pérez A, Perez JA. Selection of internal control genes for quantitative real-time RT-PCR studies during tomato development process. BMC Plant Biol. 2008; 8: 131 10.1186/1471-2229-8-131 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Wang X, Ma X, Huang L, Zhang X. Identification of the valid reference genes for quantitative RT-PCR in annual ryegrass (Lolium multiflorum) under salt stress. Molecules. 2015; 20: 4833–4847. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Lord JC, Hartzer K, Toutges M, Oppert B. Evaluation of quantitative PCR reference genes for gene expression studies in Tribolium castaneum after fungal challenge. J Microbiol Meth. 2010; 80: 219–221. [DOI] [PubMed] [Google Scholar]
  • 35.Zarivi O, Cesare P, Ragnelli AM, Aimola P, Leonardi M, Bonfigli A, et al. Validation of reference genes for quantitative real-time PCR in Perigord black truffle (Tuber melanosporum) developmental stages. Phytochemistry. 2015; 116: 78–86. 10.1016/j.phytochem.2015.02.024 [DOI] [PubMed] [Google Scholar]
  • 36.Wrzesińska B, Kierzek R, ObrePalska-StePlowska A. Evaluation of six commonly used reference genes for gene expression studies in herbicide-resistant Avena fatua biotypes. Weed Res. 2016; 56: 284–292. [Google Scholar]
  • 37.Chandna R, Augustine R, Bisht NC. Evaluation of candidate reference genes for gene expression normalization in Brassica juncea using Real Time Quantitative RT-PCR. PloS One. 2012; 7: e36918 10.1371/journal.pone.0036918 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Cheng D, Zhang Z, He X, Liang G. Validation of reference genes in Solenopsis invicta in different developmental stages, castes and tissues. PloS One. 2013; 8: e57718 10.1371/journal.pone.0057718 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 File. Sequences of reference and target genes tested in Galium aparine.

(XLS)

Data Availability Statement

All relevant data are within the paper and its Supporting Information file.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES