| Antibodies |
|
| CD4-PerCpCy5.5 Clone GK1.5 (1:800) |
Biolegend |
#100434 |
| CD4-ApcCy7 Clone GK1.5 (1:500) |
Biolegend |
#100413 |
| CD4-BV711 Clone RM4-5 (1:1000) |
Biolegend |
#100594 |
| CD8-PerCpCy5.5 Clone 53-6.7 (1:400) |
Biolegend |
#100734 |
| CD25-AF700 Clone PC61 (1:400) |
Biolegend |
#102024 |
| CD25-BV421 Clone PC61 (1:1000) |
Biolegend |
#102034 |
| CD25-BV711 Clone PC61 (1:800) |
Biolegend |
#740714 |
| CD44-PeCy7 Clone IM7 (1:400) |
Biolegend |
#103030 |
| CD45.1-PE Clone A20 (1:200) |
Biolegend |
#110708 |
| CD45.2-FITC Clone 104 (1:200) |
Biolegend |
#109806 |
| CD62L-Pacific Blue Clone MEL-14 (1:200) |
Biolegend |
#104424 |
| Foxp3-eF450 Clone FJK-16S (1:100) |
eBioscience |
#48-5773-82 |
| ICOS-BV785 Clone C398.4A (1:400) |
Biolegend |
#313534 |
| IFNγ-FITC Clone XMG1.2 (1:200) |
Biolegend |
#505806 |
| IL-10 Purified Clone JES5-16E3 (1:100) |
Biolegend |
#505001 |
| TNFα-PE Clone MP6-XT22 (1:200) |
Biolegend |
#506306 |
| β-actin (1:10,000) |
CST |
4970S |
| FABP5 (D1A7T) Rabbit mAb (1:2000) |
CST |
#3326 |
| Total OXPHOS Rodent WB Antibody Cocktail (1:2000) |
Abcam |
Ab110413 |
| Stat1 (D1K9Y) Rabbit mAb (1:2000) |
CST |
#14994 |
| Phospho-Stat1 (Tyr701) (58D6) Rabbit mAb (1:5000) |
CST |
#9167 |
| InVivoMab anti-mouse CD3 (5 μg/mL) |
BioXCell |
BP0001-1 |
| InVivioMab anti-mouse CD28 (0.5 μg/mL) |
BioXCell |
BE0015-1 |
| InVivoMab anti-mouse IL-12p40 (10 μg/mL) |
BioXCell |
BE0051 |
| InVivoMab anti-mouse IL-4 (10 μg/mL) |
BioXCell |
BE0199 |
| InVivoMab anti-mouse IFN-γ (10 μg/mL) |
BioXCell |
BE0055 |
|
| Biological Samples |
|
| Healthy Control Blood |
UniKlinik Freiburg |
N/A |
|
| Chemicals, Peptides, and Recombinant Proteins |
|
| BMS309403 |
Cayman Chemical |
#10010206 |
| C16-BODIPY |
Thermo Fisher |
D3821 |
| Cell Trace Violet |
Thermo Fisher |
C34557 |
| DMXAA |
Sigma |
D5817 |
| Mitotracker Deep Red |
Thermo Fisher |
M22426 |
| Live Dead Fixable Blue |
Thermo Fisher |
L23105 |
| IFNα |
PBL Assay Science |
#12100-1 |
| Recombinant murine IL-1β |
Peprotech |
211-11B-50 |
| Recombinant human IL-2 |
Peprotech |
200-02-1000 |
| Recombinant mouse IL-4 |
Peprotech |
214-14-100 |
| Recombinant mouse IL-6 |
Peprotech |
216-16-50 |
| Recombinant mouse IL-7 |
Peprotech |
217-17-50 |
| Recombinant mouse IL-12 |
Peprotech |
210-12-50 |
| Recombinant mouse IL-15 |
Peprotech |
210-15-15 |
| Recombinant human TGFβ |
Peprotech |
100-21-50 |
| Oligomycin |
Sigma |
#1404-19-9 |
| FCCP |
Sigma |
#370-86-5 |
| Rotenone |
Sigma |
#83-79-4 |
| Antimycin A |
Sigma |
#1397-94-0 |
|
| Critical Commercial Assays |
|
| Seahorse Extracellular Flux Analyzer XFe 96 |
Agilent |
www.agilent.com |
|
| Deposited Data |
|
| GEO Submission (GSE126245) |
|
https://www.ncbi.nlm.nih.gov/geo/ |
|
| Experimental Models: Cell Lines |
|
| E.G7-OVA |
ATCC |
ATCC Cat# CRL-2113, RRID: CVCL_3505 |
|
| Oligonucleotides |
|
| siRNA for murine cGAS |
GE Dharmacon |
#E-055608-00-0005 |
| siRNA for murine STING |
GE Dharmacon |
#E-055528-00-0005 |
| mtCytb FW (TTCATGTCGGACGAGGCTTA) |
Sigma |
N/A |
| mCytb RV (GTTTATTGGGGATTGAGCGTAG) |
Sigma |
N/A |
| mtND1 FW (CTAGCAGAAACAAACCGGGC) |
Sigma |
N/A |
| mtND1 RV (GTATGGTGGTACTCCCGCTG) |
Sigma |
N/A |
| mtND4 FW (ACAACACACACCTTAGACGCT) |
Sigma |
N/A |
| mtND4 RV (TGTGGATCCGTTCGTAGTTGG) |
Sigma |
N/A |
| Taqman 18 s Ribosomal RNA |
Thermo Fisher |
Mm03928990 |
| Taqman Fabp3 |
Thermo Fisher |
Mm02342495 |
| Taqman Fabp4 |
Thermo Fisher |
Mm00445878 |
| Taqman Fabp5 |
Thermo Fisher |
Mm00783731 |
| Taqman Il10 |
Thermo Fisher |
Mm01288386 |
| Taqman Isg15 |
Thermo Fisher |
Mm01705338 |
| Taqman Ifi44 |
Thermo Fisher |
Mm00505670 |
| Taqman Rsad2 |
Thermo Fisher |
Mm00491265 |
| Taqman Ifna4 |
Thermo Fisher |
Mm00833969 |
| Taqman Acaa2 |
Thermo Fisher |
Mm00624282 |
| Taqman Elovl6 |
Thermo Fisher |
Mm00851223 |
| Taqman Fads1 |
Thermo Fisher |
Mm00507605 |
| Taqman Fads2 |
Thermo Fisher |
Mm00517221 |
| Taqman Scd1 |
Thermo Fisher |
Mm00772290 |
| Taqman Scd2 |
Thermo Fisher |
Mm01208542 |
|
| Software and Algorithms |
|
| Wave Software Version 2.4 |
Agilent |
www.aglient.com |
| FlowJo v10 |
FlowJo |
www.flowjo.com |
| GraphPad Prism 6 |
GraphPad Software |
www.graphpad.com |