Antibodies |
|
Armenian Hamster monoclonal anti-CD3ε (clone 145-2C11) APC conjugated |
BD Biosciences |
Cat# 553066, RRID:AB_398529
|
Armenian Hamster monoclonal anti-CD3ε (clone 145-2C11) PE conjugated |
BD Biosciences |
Cat# 553063, RRID:AB_394596
|
Goat polyclonal anti-CD3ε |
Santa Cruz Biotechnology |
Cat# sc-1127, RRID:AB_631128
|
Rat monoclonal anti-CD4 (clone RM4-4) |
BD Biosciences BioLegend |
Cat#: 553053, RRID: AB_394588
|
Cat#: 116018, RRID: AB_2650936
|
Rat monoclonal anti-CD4 (clone RM4-4) FITC conjugated |
BioLegend |
Cat#: 116003, RRID: AB_313688
|
Rat monoclonal anti-CD4 (clone RM4-4) PE conjugated |
BioLegend |
Cat# 116006, RRID: AB_313691
|
Rat monoclonal anti-CD4 (clone RM4-5) biotin conjugated |
BD Biosciences |
Cat# 553649, RRID:AB_394969
|
Rat monoclonal anti-CD4 (clone RM4-5) PE conjugated |
BD Biosciences |
Cat# 553049, RRID:AB_394585
|
Rat monoclonal anti-CD4 (clone RM4-5) BV650 conjugated |
BioLegend |
Cat# 100545, RRID:AB_11126142
|
Rat monoclonal anti-CD4 (clone RM4-5) APC conjugated |
BD Biosciences |
Cat# 553051, RRID:AB_398528
|
Rat monoclonal anti-CD4 (clone RM4-5) AF700 conjugated |
BD Biosciences |
Cat# 557956, RRID:AB_396956
|
Rat monoclonal anti-CD4 (clone H129.19) PE conjugated |
BD Biosciences |
Cat# 553652, RRID:AB_394972
|
Rat monoclonal anti-CD4 (clone H129.19) FITC conjugated |
BD Biosciences |
Cat# 553651, RRID:AB_394971
|
Rat monoclonal anti-CD4 (clone GK1.5) Alexa Fluor 488 cojungated |
Biolegend |
Cat# 100423, RRID:AB_389302
|
Rabbit monoclonal anti-CD4 (clone D7D2Z) |
Cell Signaling Technology |
Cat# 25229, RRID:AB_2798898
|
Rat monoclonal anti-CD4 (clone YTS 177.9) biotin conjugated |
Tomas Brdicka’s lab |
N/A |
Rat monoclonal anti-CD8a (clone 53-5.7) FITC conjugated |
BD Biosciences BioLegend |
Cat# 553032, RRID:AB_394570
|
Cat# 100706, RRID:AB_312745
|
Rat monoclonal anti-CD8a (clone 53-5.7) BV421 conjugated |
BioLegend |
Cat# 100737, RRID:AB_10897101
|
Rat monoclonal anti-CD8a (clone 53-5.7) PE conjugated |
BD Biosciences |
Cat# 553033, RRID:AB_394571
|
Rabbit monoclonal anti-CD8a (clone D4W2Z) |
Cell Signaling Technology |
Cat# 98941, RRID:AB_2756376
|
Rat monoclonal anti-CD8b.2 (clone 53-5.8) |
BD Biosciences |
Cat# 553038, RRID:AB_394574
|
Rat monoclonal anti-CD8b.2 (clone 53-5.8) Biotin cojugated |
BD Biosciences |
Cat# 553039, RRID:AB_394575
|
Rat monoclonal anti-CD8b.2 (clone 53-5.8) FITC conjugated |
BD Biosciences |
Cat# 553040, RRID:AB_394576
|
Rat monoclonal anti-CD8b.2 (clone 53-5.8) PerCP-Cy5.5 conjugated |
BioLegend |
Cat# 140417, RRID:AB_2800650
|
Rat monoclonal anti-CD8b (clone eBioH35-17.2) PE-Cy7 conjugated |
Thermo Fisher Scientific |
Cat# 25-0083-82, RRID:AB_11218494
|
Rat monoclonal anti-CD11b (clone YBM 15.1.6) biotin conjugated |
Tomas Brdicka’s lab |
N/A |
Rat monoclonal anti-CD25 (clone PC61) PE-Cy7 conjugated |
BioLegend |
Cat# 102016, RRID:AB_312865
|
Rat monoclonal anti-CD44 (clone IM7) PerCP-Cy5.5 conjugated |
BioLegend |
Cat# 103032, RRID:AB_2076204
|
Rat monoclonal anti-CD44 (clone IM7) BV650 conjugated |
BioLegend |
Cat# 103049, RRID:AB_2562600
|
Rat monoclonal anti-CD44 (clone IM7) biotin conjugated |
BioLegend |
Cat# 103003, RRID:AB_312954
|
Mouse monoclonal anti-CD45.2 (clone 104) APC-Cy7 conjugated |
BD Biosciences |
Cat# 560694, RRID:AB_1727492
|
Mouse monoclonal anti-CD45.2 (clone 104) Alexa Fluor 700 conjugated |
Biolegend |
Cat# 109822, RRID:AB_493731
|
Rat monoclonal anti-CD45R/B220 (clone RA3-6B2) biotin conjugated |
BD Biosciences |
Cat# 553085, RRID:AB_394615
|
Rat monoclonal anti-CD62L (clone MEL-14) PE-Cy7 conjugated |
BioLegend |
Cat# 104418, RRID:AB_313103
|
Armenian Hamster monoclonal anti-CD69 FITC conjugated |
BD Biosciences |
Cat# 553236, RRID:AB_394725
|
Mouse monoclonal anti-Lck (clone 3a5) |
Santa Cruz Biotechnology |
Cat# sc-433, RRID:AB_627880
|
Mouse monoclonal anti-Lck (clone 3a5) PE conjugated |
Santa Cruz Biotechnology |
Cat# sc-433 PE, RRID: N/A |
Mouse monoclonal anti-MHCI (H2Kb; clone Y3.8) |
Ed Palmer’s lab, University of Basel |
N/A |
Armenian Hamster monoclonal anti-TCRβ (clone H57-597) APC conjugated |
BD Biosciences Biolegend |
Cat# 553174, RRID:AB_398534
|
Cat# 109212, RRID:AB_313435
|
Rabbit monoclonal anti-Phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (clone D13.14.4E) |
Cell Signaling Technology |
Cat# 4370, RRID:AB_2315112
|
Mouse monoclonal anti-Src, non-phospho (Tyr416) (clone 7G9) |
Cell Signaling Technology |
Cat# 2102, RRID:AB_331358
|
Rabbit polyclonal anti-Phospho-Src Family (Tyr416) |
Cell Signaling Technology |
Cat# 2101, RRID:AB_331697
|
Mouse monoclonal anti-Phosphotyrosine (clone 4G10) PE conjugated |
Millipore |
Cat# FCMAB323PE, RRID:AB_10805942
|
Mouse monoclonal anti-CD247 phospho (Tyr142) (clone K25-407.69) PE conjugated |
BD Biosciences |
Cat# 558448, RRID:AB_647237
|
Rabbit monoclonal anti-Phospho-Zap-70 (Tyr319)/Syk (Tyr352) (clone 65E4) |
Cell Signaling Technology |
Cat# 2717, RRID:AB_2218658
|
Mouse monoclonal anti-Lamin B1 (clone 119D5-F1) |
Santa Cruz Biotechnology |
Cat# sc-56143, RRID:AB_2136302
|
Mouse monoclonal anti-Zap70 (clone 1E7.2) Alexa Fluor 488 conjugated |
Thermo Fisher Scientific |
Cat# MHZAP7020, RRID:AB_10375316
|
Rabbit polyclonal anti-GAPDH |
Sigma-Aldrich |
Cat# G9545, RRID:AB_796208
|
Donkey polyclonal anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 555 conjugated |
Thermo Fisher Scientific |
Cat# A-31572, RRID:AB_162543
|
Goat polyclonal anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 555 conjugated |
Thermo Fisher Scientific |
Cat# A-21429, RRID:AB_2535850
|
Goat polyclonal anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 conjugated |
Thermo Fisher Scientific |
Cat# A-11034, RRID:AB_2576217
|
Goat polyclonal anti-mouse IgG (H+L) Secondary Antibody, HRP conjugated |
Jackson ImmunoResearch Labs |
Cat# 115-035-003, RRID:AB_10015289
|
Donkey polyclonal anti-Goat IgG (H+L) antibody, HRP conjugated |
Jackson ImmunoResearch Labs |
Cat# 705-035-003, RRID:AB_2340390
|
Goat polyclonal anti-rabbit IgG (H+L) Secondary Antibody, HRP conjugated |
Jackson ImmunoResearch Labs |
Cat# 111-035-003, RRID:AB_2313567
|
|
Bacterial and Virus Strains |
|
Listeria monocytogenes (transfected with empty pPL1,pPL2) |
(Zehn et al., 2009) |
N/A |
Listeria monocytogenes expressing SIINFEKL (OVA) peptide (transfected with pPL1,pPL2 carrying OVA peptide coding sequence) |
(Zehn et al., 2009) |
N/A |
Listeria monocytogenes expressing SIITFEKL (T4) peptide (transfected with pPL1,pPL2 carrying T4 peptide coding sequence) |
(Zehn et al., 2009) |
N/A |
Listeria monocytogenes expressing SIIQFEHL (Q4H7) peptide (transfected with pPL1,pPL2 carrying Q4H7 peptide coding sequence) |
(King et al., 2012) |
N/A |
Listeria monocytogenes expressing FEAQKAKANKAVD (3K) peptide (transfected with pPL1,pPL2 carrying 3K peptide coding sequence) |
This paper |
N/A |
Listeria monocytogenes expressing FEAAKAKANKAVD (P2A) peptide (transfected with pPL1,pPL2 carrying P2A peptide coding sequence) |
This paper |
N/A |
Listeria monocytogenes expressing FAAQKAKANKAVD (P-1A) peptide (transfected with pPL1,pPL2 carrying P-1A peptide coding sequence) |
This paper |
N/A |
|
Chemicals, Peptides, and Recombinant Proteins |
|
AccuCheck Counting Beads |
Thermo Fisher Scientific |
Cat# PCB100 |
Qdot 605 Streptavidin Conjugate |
Invitrogen |
Cat# Q10103MP |
CML Latex Beads, 4% w/v, 5 μm |
Thermo Fisher Scientific |
Cat# C37255
|
Nonidet P 40 Substitute |
Sigma Aldrich |
Cat# 74385 |
n-Dodecyl-beta-Maltoside Detergent |
Thermo Fisher Scientific |
Cat# 89903 |
cOmplete, EDTA-free Protease Inhibitor Cocktail Tablets |
Roche |
Cat# 05056489001 |
4-(2-Aminoethyl)benzenesulfonyl fluoride hydrochloride |
Sigma Aldrich |
Cat# A8456 |
PhosSTOP |
Roche Molecular Systems, Inc |
Cat# 04906837001 |
Amersham Protran 0.45 NC nitrocellulose western blotting membranes |
GE Healthcare |
Cat# 10600002 |
Streptavidin Mag Sepharose |
GE Healthcare |
Cat# 28985738 |
LPS E.Coli O111:B4 |
Sigma Aldrich |
Cat# LPS25 |
OVA peptide (SIINFEKL) |
Eurogentec |
Ref# AS-60193-1 |
T4 peptide (SIITFEKL) |
Eurogentec |
Ref# AS-64403 |
Q4H7 peptide (SIIQFEHL) |
Eurogentec |
Ref# AS-64405 |
3K peptide (FEAQKAKANKAVD) |
Peptides and Elephants |
N/A |
P2A peptide (FEAAKAKANKAVD) |
Peptides and Elephants |
N/A |
P-1A peptide (FAAQKAKANKAVD) |
Peptides and Elephants |
N/A |
(+)-Biotin N-hydroxysuccinimide ester |
Sigma Aldrich |
Cat# H1759 |
Sephadex® G-25 |
Sigma Aldrich |
Cat# S5772 |
|
Critical Commercial Assays |
|
LIVE/DEAD Fixable Near-IR Dead Cell Stain Kit |
Thermo Fisher Scientific |
L34976 |
CellTrace CFSE Cell Proliferation Kit |
Thermo Fisher Scientific |
C34554 |
Untouched Mouse CD8 Cells Kit |
Dynabeads |
Cat# 11417D |
Untouched Mouse CD4 Cells Kit |
Dynabeads |
Cat# 11415D |
Biotin Binder |
Dynabeads |
Cat# 11047 |
EasySep Mouse CD8 T Cell Enrichment Kit |
Stem Cell |
Cat# 19753A |
RNA Clean and Concentrator-5
|
Zymo Research |
Cat# R1013 |
Neuraminidase from Vibrio cholera, type II |
Sigma Aldrich |
Cat# N6514 |
|
Experimental Models: Cell Lines |
|
Lutz |
N/A |
N/A |
|
Experimental Models: Organisms/Strains |
|
Mouse: C57BL/6J |
Animal Facility of Institute of Molecular Genetics |
JAX 000664 |
Mouse: C57BL/6J CD45.1 |
(Shen et al., 1985) |
JAX 002014 |
Mouse: CD3ε−/−
|
(Sommers et al., 2000) |
JAX 004177 |
Mouse: CD8.4 |
(Erman et al., 2006) |
N/A |
Mouse: OT-I Rag2−/−
|
(Hogquist et al., 1994, Shinkai et al., 1992) |
N/A |
Mouse: B3K508 Rag2−/−
|
(Huseby et al., 2005, Shinkai et al., 1992) |
N/A |
Mouse: FoxP3−/−
|
(Lin et al., 2005) |
JAX 019933 |
Mouse: Nur77-GFP |
(Moran et al., 2011) |
JAX 016617 |
Mouse: FoxP3-GFP |
(Fontenot et al., 2005) |
N/A |
Mouse: FoxP3-DTR |
(Kim et al., 2007) |
JAX 016958 |
Mouse: Lck−/−
|
This paper |
N/A |
|
Oligonucleotides |
|
CD8 Forward – CCGTGGCTCAGTGAAGGGG |
Sigma Aldrich |
N/A |
CD8’ Reverse – CTGACTAGCGGCTGTGGTAGC |
Sigma Aldrich |
N/A |
CD8 Full length Reverse – CATTTGCAAACACGCTTTCGGCTC |
Sigma Aldrich |
N/A |
CD8 Total Reverse - CTTGCCTTCCTGTCTGACTAGC |
Sigma Aldrich |
N/A |
gRNA for Lck−/− generation: TTGCTGTCCAGTGGGACTAT GGG
|
N/A |
N/A |
|
Software and Algorithms |
|
Source code for ‘Lck come&stay/signal duration’ model (MATLAB) |
This paper (Data S1) |
N/A |
GraphPad Prism 5.04 |
GraphPad Software |
N/A |
FlowJo V9 and V10 |
FlowJo, LCC |
N/A |
R Studio V1.2.1335 |
RStudio, Inc. |
N/A |
Tescan Q-Phase software V7.727 |
Tescan Orsay Holding, a.s |
N/A |
Fiji (ImageJ version 1.52i) |
Open Source |
N/A |
MATLAB |
MathWorks |
N/A |
|
Other |
|
LSRII |
BD Biosciences |
N/A |
CantoII |
BD Biosciences |
N/A |
FACSymphony |
BD Biosciences |
N/A |
LSRFortessa |
BD Biosciences |
N/A |
Influx Sorter |
BD Biosciences |
N/A |
Cytek™ Aurora |
Cytek |
N/A |
LI-COR Odyssey infrared imaging system |
LI-COR Biosciences |
N/A |
Azure c200 imaging system |
Azure Biosystems |
N/A |
Z2 Coulter Counter Analyzer |
Beckman Coulter |
N/A |
LightCycler® 480 Instrument II |
Roche Molecular Systems, Inc |
N/A |