Skip to main content
. 2020 Feb 5;51:9. doi: 10.1186/s13567-020-0737-9

Table 2.

Oligonucleotide primers used for amplification of the second exon of the Ovar-DRB1 locus.

Adapted from [6]

Primer name Position relative to the first base of the second exon of the Ovar-DRB1 locus Forward (F) or reverse (R) Sequence
275 Intron 1 (−55 to −35) F ATTAGCCTCTCCCCAGGAGTC
329 Exon 2/intron 2 (263 to +15) R CACCCCCGCGCTCAC/CTCGCCGC
330 Intron 1 (−55 to −35) F ATTAGCCTCYCCCCAGGAGKC
455 Intron 1/exon 2 (−16 to +8) F TATCCCGTCTCTGCAG/CACATTTC
KBEH1 Intron 1/exon 2 (−7 to +14) F TCTGCAG/CACATTTCYTGGAG

Intron 1 sequence is indicated as negative, intron 2 sequence is indicated as positive. Positions 1 to 270 indicate exon 2. The intron exon boundary is marked by /.