Table 2.
Oligonucleotide primers used for amplification of the second exon of the Ovar-DRB1 locus.
Adapted from [6]
| Primer name | Position relative to the first base of the second exon of the Ovar-DRB1 locus | Forward (F) or reverse (R) | Sequence |
|---|---|---|---|
| 275 | Intron 1 (−55 to −35) | F | ATTAGCCTCTCCCCAGGAGTC |
| 329 | Exon 2/intron 2 (263 to +15) | R | CACCCCCGCGCTCAC/CTCGCCGC |
| 330 | Intron 1 (−55 to −35) | F | ATTAGCCTCYCCCCAGGAGKC |
| 455 | Intron 1/exon 2 (−16 to +8) | F | TATCCCGTCTCTGCAG/CACATTTC |
| KBEH1 | Intron 1/exon 2 (−7 to +14) | F | TCTGCAG/CACATTTCYTGGAG |
Intron 1 sequence is indicated as negative, intron 2 sequence is indicated as positive. Positions 1 to 270 indicate exon 2. The intron exon boundary is marked by /.