Table 1. Nucleotide sequences of forward and reverse primers used for the amplification of genes from the genomic DNA of M. tuberculosis and cloning of the amplified products in pGEM-T Easy, pGES-TH-1 and pDE22 vectors.

Gene	Nucleotide sequences of forward primers	Nucleotide sequences of reverse primers
pe35	5’-aatcggatccatggaaaaaatgtcacatgatccg-3	5’ acgaagcttttcggcgaagacgccggcggcgccgt 3’
esxa	5’ aatcggatccatgacagagcagcagtggaatttc 3’	5’ acgaagctttgcgaacatcccagtgacgtt 3’
esxb	5’ aatcggatccatggcagagatgaagaccgatgcc 3’	5’ acgaagcttgaagcccatttgcgaggacag 3’
rv2346c	5’ aatcggatccatgaccatcaactatcagttcggt 3’	5’ acgaagcttggcccagctggagccgacggcgct 3’
rv2347c	5’ aatcggatccatggcaacacgttttatgacggat 3’	5’ acgaagcttgctgctgaggatctgctgctgggaggc 3’
rv3619c	5’ aatcggatccatgaccatcaactatcaattcggg 3’	5’ acgaagcttggcccagctggagccgacggcgct 3’
rv3620c	5’ aatcggatccatgacctcgcgttttatgacggat 3’	5’ acgaagcttgctgctgaggatctgctgctgggaggc 3’

The restriction sites for BamH I and Hind III are underlined in the forward and reverse primers, respectively.