Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background C. elegans | JH3503 | Smith et al., 2016 | meg-3(ax3054[meg-3::meGFP]) X. | |
| Strain, strain background C. elegans | JH3269 | Putnam et al., 2019 | pgl-1(ax3122[pgl-1::GFP]) IV. | |
| Strain, strain background C. elegans | JH3193 | Paix et al., 2014 | nos-2(ax2049[3xFLAG::nos-2]) II. | |
| Strain, strain background C. elegans | JH3605 | This study | Y51F10.2(ax4319[Y51F10.2::OLLAS]) I | |
| Strain, strain background C. elegans | EGD364 | Wu et al., 2019 | meg-3(egx4[meg-3::Halo]) X. | |
| Strain, strain background C. elegans | JH3475 | Smith et al., 2016 | meg-3(ax3055) meg-4(ax3052) X | |
| Strain, strain background C. elegans | WM527 | Shen et al., 2018 | prg-1(ne4523 [gfp::tev::flag::prg-1]) I | |
| Strain, strain background C. elegans | JH3357 | Lee et al., 2017 | nos-2(ax3103[nos-2△]) II | |
| Strain, strain background C. elegans | SS608 | Kawasaki et al., 2004 | pgl-3(bn103[pgl-3△]) V | |
| Strain, strain background C. elegans | SX922 | Caenorhabditis Genetics Center | prg-1(n4357[prg-1△])I | |
| Strain, strain background C. elegans | JH3229 | Wang et al., 2014 | meg-1(vr10) meg-3(tm4259)X | |
| Strain, strain background C. elegans | JH3740 | This study | meg-3(ax3055) meg-4(ax3052) X; Y51F10.2(ok1610) I | |
| Strain, strain background C. elegans | JH3743 | This study | nos-2(ax3130) II; Y51F10.2(ok1610) I | |
| Strain, strain background C. elegans | JH3746 | This study | meg-3(ax3055) meg-4(ax3052) X; nos-2(ax3130) II. 100% sterile, no clone was maintained. | |
| Strain, strain background C. elegans | JH1904 | This study | Unc-119(ed3) III; axls1374[Ppie1::GFP] | |
| Strain, strain background C. elegans | JH2878 | Leacock and Reinke, 2008 | meg-1(vr10) X | |
| Strain, strain background C. elegans | JH3562 | This study | meg-3(ax3054[MEG-3::meGFP]) X; K08F4.2 (ax5000[gtbp-1::tagRFP]) IV | |
| Strain, strain background C. elegans | RB1413 | Caenorhabditis Genetics Center | Y51F10.2(ok161) I | |
| Antibody | K76 | DSHB,PMID: 28787592 | RRID:AB_531836 | (1:15) |
| Antibody | Anti-FLAG M2 | Sigma-Aldrich Cat# F3165 | RRID:AB_259529 | (1:200) |
| Antibody | Donky-anti-mouse IgM 647 |
Jackson ImmunoResearch Labs | RRID:AB_2340861 | (1:400) |
| Antibody | Goat anti-Rabit IgG (H+L) 568 | Molecular probes cat# A-11011 | RRID:AB_143157 | (1:400) |
| Antibody | Anti-OLLAS-L2 | Novus cat# NBP1-06713 | RRID:AB_1625979 | (1:200) |
| Antibody | Anti-OLLAS | other | gift from Dr. Jeremy Nathans | |
| Antibody | Anti-GFP | Rohe | RRID:AB_390913 | For conjugation |
| Sequence-based reagent | oCYL1089: crRNA to cut Y51F10.2 at 3' end | This study | GTGCTCAAAATAGTAGGCGA | |
| Sequence-based reagent | oCYL1143: repair oligo of Y51F10.2 C-ter Ollas tag (+) | This study | TCCAGCGCCAGCACCACCATTCGAC AACTCCGTCGCCTACTATTTTGGAGGAT CCGGAtccggattcgccaacGAGCTCggac cacgtctcatgggaaagGGAGGATCCGG AGAGCACCAATTTTGA gcttttatatttttttttctc | |
| Sequence-based reagent | oCYL1144: repair oligo of Y51F10.2 C-ter Ollas tag (-) | This study | gagaaaaaaaaatataaaagc TCAAAATTGGTGCTCTCCGGATCCTC CctttcccatgagacgtggtccGAGCTCgtt ggcgaatccggaTCCGG ATCCTCCAAAAT AGTAGGCGACGGAGTTGTCGA ATGGTGGTGCTGGCGCTGGA | |
| Sequence-based reagent | oCYL1096:5' PCR primer 333 bp up of Y51F10.2 TGA stop | This study | GTTTCCAGCCGCTTGACAAG | |
| Sequence-based reagent | GTTTCCAGCCGCTTGACAAG | This study | CTGATCCTCCCCCTTCTTCG | |
| Sequence-based reagent | oCYL1259:5' PCR primer contains T7 promoter for in vitro transcription of T19H12.2 mRNA. | This study | CATGATTACTAATACG ACTCACTATA GGGaccagctcacga aactaacaatg | |
| Sequence-based reagent | oCYL1260:3' PCR primer at the end of T19H12.2 3UTR for T7 in vitro transcription | This study | gaaagcgaaagaaatttt attttacaggagg | |
| Sequence-based reagent | oCYL1261:5' PCR primer contains T7 promoter for in vitro transcription of dao-5 mRNA including utr. | This study | catgattacTAATACGACT CACTATAGGG ggtacccctgatcgctATGAG | |
| Sequence-based reagent | oCYL1262:3' PCR primer at the end of dao-5 3UTR for T7 in vitro transcription | This study | ggaccaaacattttatggat gagacaag | |
| Sequence-based reagent | oCYL1263:5' PCR primer contains T7 promoter forin vitro transcription of hil-5 mRNA. | This study | catgattacTAATACGACT CACTATAGGG actatcacttttcaagtgtttgttcatcg | |
| Sequence-based reagent | oCYL1264:3' PCR primer at the end of hil-5 3UTR for T7 in vitro transcription | This study | agaatctattaatggtttattggaa ggtatatttgttaaaatg | |
| Sequence-based reagent | oCYL1265:5' PCR primer contains T7 promoter forin vitro transcription of pbs-7 mRNA including utr. | This study | catgattacTAATACGACT CACTATAGGG gcatttcattgtcgaaattcacttcctttc | |
| Sequence-based reagent | oCYL1266:3' PCR primer at the end of pbs-7 3UTR for T7in vitro transcription | This study | agaaggattaaatggaag tttatttatcgacttc | |
| Sequence-based reagent | oCYL1267:5' PCR primer contains T7 promoter for in vitro transcription of T07C4.3a mRNA including utr. | This study | catgattacTAATACGACT CACTATAGGG gtttgtgcactcactacgaaatctc | |
| Sequence-based reagent | oCYL1268:3' PCR primer at the end of T07C4.3a 3UTR for T7 in vitro transcription | This study | catcaaaatattctttcatt taacaaaaacagaaacaac | |
| Recombinant DNA reagent | plasmid: 6XHis-MEG-3 | Smith et al., 2016 | ||
| Recombinant DNA reagent | plasmid: MBP-HIS-TEV-PGL-3 | Putnam et al., 2019 | ||
| Chemical compound, drug | SYTO 14 | ThermoFisher Cat#S7572 | In vivo RNA labeling | |
| Chemical compound, drug | Alexa Fluor 647 NHS Ester | ThermoFisher Cat#A37573 | protein labeling | |
| Chemical compound, drug | DyLight 488 NHS Ester | ThermoFisher Cat#46403 | protein labeling | |
| Chemical compound, drug | ChromaTide Alexa Fluor 488–5-UTP | ThermoFisher Cat#C11403 | RNA labeling | |
| Chemical compound, drug | ChromaTide Alexa Fluor 546–14-UTP | ThermoFisher Cat#C11404 | RNA labeling | |
| Recombinant DNA reagent | plasmid: cDNA of pbs-7 | this paper | pbs-7 cDNA, pUC19 vector | |
| Recombinant DNA reagent | plasmid: cDNA of dao-5 | this paper | dao-5 cDNA, pUC19 vector | |
| Recombinant DNA reagent | plasmid: cDNA of T19H12.2 | this paper | T19H12.2 cDNA, pUC19 vector | |
| Recombinant DNA reagent | plasmid: cDNA of hil-5 | this paper | hil-5, pUC19 vector | |
| Recombinant DNA reagent | plasmid: cDNA of Y51F10.2 | this paper | Y51F10.2 cDNA, PCR blunt II topo vector | |
| Recombinant DNA reagent | plasmid: cDNA of nos-2 | this paper | nos-2 cDNA, PCR blunt II topo vector | |
| Recombinant DNA reagent | plasmid: cDNA of skr-2 | this paper | skr-2 cDNA, PCR blunt II topo vector | |
| Recombinant DNA reagent | plasmid: cDNA of R04D3.2 | this paper | R04D3.2 cDNA, PCR blunt II topo vector | |
| Recombinant DNA reagent | plasmid: cDNA of C46A5.6 | this paper | C46A5.6 cDNA, PCR blunt II topo vector | |
| Software, algorithm | DESeq2 | https://bioconductor.org/packages/release/bioc/html/DESeq2.html | RRID:SCR_015687 | |
| Software, algorithm | hisat2 | DOI:10.1038/nprot.2016.095 | RRID:SCR_015530 | |
| Software, algorithm | htseq-count | DOI:10.1093/bioinformatics/btu638 | RRID:SCR_011867 | |
| Software, algorithm | cuffdiff | http://cole-trapnell-lab.github.io/cufflinks/ | RRID:SCR_001647 | |
| Software, algorithm | Slidebook 6 | https://www.intelligent-imaging.com/slidebook | RRID:SCR_014300 | |
| Software, algorithm | Deeptools | https://deeptools.readthedocs.io/en/develop/ | RRID:SCR_016366 | |
| Software, algorithm | icount | https://github.com/tomazc/iCount | RRID:SCR_016712 | |
| Software, algorithm | smatools | http://samtools.sourceforge.net/ | RRID:SCR_002105 | |
| Software, algorithm | BEDTools | https://github.com/arq5x/bedtools2 | RRID:SCR_006646 | |
| Software, algorithm | Galaxy | https://usegalaxy.eu/ | RRID:SCR_006281 | |
| Software, algorithm | Rstusio | http://www.rstudio.com/ | RRID:SCR_000432 | |
| Software, algorithm | STAR | https://github.com/alexdobin/STAR | RRID:SCR_015899 |