Skip to main content
. 2020 Feb 11;9:e52283. doi: 10.7554/eLife.52283

Key resources table.

Reagent type
(species) or
resource
Designation Source or
reference
Identifiers Additional
information
Gene (Rattus norvegicus) ATG7 N/A Gene-NCBI: ID: NC_005103.4
Strain, strain background (Mus musculus) C57BL/6 Jackson Laboratoy 664 female and male
Strain, strain background (Rattus norvegicus) Long Evans Charles River 6 N/A
Cell line (Rattus norvegicus) primary cortical neurons Neurons isolated from Long-Evans rat embryos (E17–18) cortices
Antibody anti-microubule-associated protein 1 light chain three alpha (LC3; rabbit polyclonal) MBL #PD014 (1:1000), overnight 4°C
Antibody anti-atg7 (clone D12B11; rabbit monoclonal) Cell Signaling #8558 (1:1000), overnight 4°C
Antibody anti-beta actin (clone 8H10D10; mouse monoclonal) Cell Signaling #3700 (1:2000), overnight 4°C
Antibody anti-DYKDDDDK Tag (FLAG; clone D6W5B; rabbit polyclonal) Cell Signaling #2368 (1:500), overnight 4°C
Antibody anti-microtubule-associated protein-2 (MAP-2; clone A-4; mouse monoclonal) Santa Cruz Biotechnology #sc-74421 (1:500), overnight 4°C
Antibody anti-rabbit-HRP EMD Millipore #AP307P (1:2000), overnight 4°C
Antibody anti-mouse-HRP EMD Millipore #AP308P (1:2000), overnight 4°C
Antibody anti-mouse Alexa Fluor-488 Life Technologies #A11001 (1:500), overnight 4°C
Antibody anti-Huntingtin protein (Htt; clone mEM48; mouse monoclonal) EMD Millipore #MAB5374 (1:1000), overnight 4°C
Antibody anti-rabbit Alexa Fluor-546 Life Technologies #A11010 (1:500), overnight 4°C
Antibody anti-HF2 (Lopez et al., 2017) (1:100), overnight 4°C, prepared in Nayun Kim’s lab
Antibody anti-BG4  (Biffi et al., 2013) (1:100), overnight 4°C, prepared in Nayun Kim’s lab
Recombinant DNA reagent lipofectamine 2000 Thermo Fisher Scientific 12566014
Recombinant DNA reagent pCAG-TagBFP VectorBuilder pRP[Exp]-CAG > TagBFP
Recombinant DNA reagent pCAG-EGFP-hPIF1 VectorBuilder pRP[Exp]-CAG > EGFP(ns): hPIF1[ORF026999]
Recombinant DNA reagent pCAG-EGFP-mutant hPIF1 VectorBuilder pRP[Exp]-CAG > EGFP(ns):{hPIF1[ORF026999]*(E307Q)}
Recombinant DNA reagent EF1A-mApple-ATG7 VectorBuilder pRFP[Exp]-EF1A > mApple(ns):mAtg7[NM_001253717.1]
Recombinant DNA reagent pSANG10-3F-BG4 Addgene #55756; deposited by Dr. Shankar Balasubramanian, the University of Cambridge
Recombinant DNA reagent pGW1-Dendra2-LC3 (Tsvetkov et al., 2013b)
Recombinant DNA reagent Httex1-Q46-Dendra2 (Tsvetkov et al., 2013b)
Recombinant DNA reagent pGW1-mito-Keima other It was cloned from the mt-mKeima/pIND(SP1) construct that we kindly received from Dr. Atsushi Miyawaki (RIKEN Brain Science Institute, Japan)
Sequence-based reagent ATG7, forward Lone Star laboratories 5’-TCCTGAGAGCATCCCTCTAATC-3’
Sequence-based reagent ATG7, reverse Lone Star laboratories 5’- CTTCAGTTCGACACAGGTCATC-3’
Sequence-based reagent TBP, forward Lone Star laboratories 5’-AGTGCCCAGCATCACTGTTT-3’
Sequence-based reagent TBP, reverse Lone Star laboratories 5’-GGTCCATGACTCTCACTTTCTT-3’
Sequence-based reagent ATG2700 Dr. Monchaud lab. ATTCTTGGGGCTGGGGTCCCT TGGGGAACTGTATTGGGTGAACC
Sequence-based reagent SS-DNA Dr. Monchaud lab. GCACGCGTATCTTTTTGGCGCAGGTG
Commercial assay or kit RNeasy Mini kit Qiagen 74104
Commercial assay or kit iScript Reverse Transcription SuperMix BioRad 1708840
Chemical compound, drug Pyridostatin (PDS) Cayman Chemical 18013
Chemical
compound, drug
10-(4′-(N-diethylamino)butyl)−2-chlorophenoxazine (10-NCP) EMD Millipore 925681–41
Chemical compound, drug N-TASQ  (Laguerre et al., 2015; Laguerre et al., 2016) synthesized by Dr. David Monchaud
Software, algorithm JMP software SAS Institute, Houston, TX
Other Hoechst dye Santa Cruz Biotechnology sc-394039
Other poly-D-lysine Millipore A-003-E
Other Neurobasal Medium Life Technologies 21103–049
Other B-27 Life Technologies 17504–044
Other GlutaMAX Life Technologies 35050–061
Other penicillin-streptomycin Life Technologies 15240.062
Other HisPur Ni-NTA resin Thermo Scientific 88221
Other Dynabeads ThermoFisher Scientific 10002D