Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Rattus norvegicus) | ATG7 | N/A | Gene-NCBI: ID: NC_005103.4 | |
| Strain, strain background (Mus musculus) | C57BL/6 | Jackson Laboratoy | 664 | female and male |
| Strain, strain background (Rattus norvegicus) | Long Evans | Charles River | 6 | N/A |
| Cell line (Rattus norvegicus) | primary cortical neurons | Neurons isolated from Long-Evans rat embryos (E17–18) cortices | ||
| Antibody | anti-microubule-associated protein 1 light chain three alpha (LC3; rabbit polyclonal) | MBL | #PD014 | (1:1000), overnight 4°C |
| Antibody | anti-atg7 (clone D12B11; rabbit monoclonal) | Cell Signaling | #8558 | (1:1000), overnight 4°C |
| Antibody | anti-beta actin (clone 8H10D10; mouse monoclonal) | Cell Signaling | #3700 | (1:2000), overnight 4°C |
| Antibody | anti-DYKDDDDK Tag (FLAG; clone D6W5B; rabbit polyclonal) | Cell Signaling | #2368 | (1:500), overnight 4°C |
| Antibody | anti-microtubule-associated protein-2 (MAP-2; clone A-4; mouse monoclonal) | Santa Cruz Biotechnology | #sc-74421 | (1:500), overnight 4°C |
| Antibody | anti-rabbit-HRP | EMD Millipore | #AP307P | (1:2000), overnight 4°C |
| Antibody | anti-mouse-HRP | EMD Millipore | #AP308P | (1:2000), overnight 4°C |
| Antibody | anti-mouse Alexa Fluor-488 | Life Technologies | #A11001 | (1:500), overnight 4°C |
| Antibody | anti-Huntingtin protein (Htt; clone mEM48; mouse monoclonal) | EMD Millipore | #MAB5374 | (1:1000), overnight 4°C |
| Antibody | anti-rabbit Alexa Fluor-546 | Life Technologies | #A11010 | (1:500), overnight 4°C |
| Antibody | anti-HF2 | (Lopez et al., 2017) | (1:100), overnight 4°C, prepared in Nayun Kim’s lab | |
| Antibody | anti-BG4 | (Biffi et al., 2013) | (1:100), overnight 4°C, prepared in Nayun Kim’s lab | |
| Recombinant DNA reagent | lipofectamine 2000 | Thermo Fisher Scientific | 12566014 | |
| Recombinant DNA reagent | pCAG-TagBFP | VectorBuilder | pRP[Exp]-CAG > TagBFP | |
| Recombinant DNA reagent | pCAG-EGFP-hPIF1 | VectorBuilder | pRP[Exp]-CAG > EGFP(ns): hPIF1[ORF026999] | |
| Recombinant DNA reagent | pCAG-EGFP-mutant hPIF1 | VectorBuilder | pRP[Exp]-CAG > EGFP(ns):{hPIF1[ORF026999]*(E307Q)} | |
| Recombinant DNA reagent | EF1A-mApple-ATG7 | VectorBuilder | pRFP[Exp]-EF1A > mApple(ns):mAtg7[NM_001253717.1] | |
| Recombinant DNA reagent | pSANG10-3F-BG4 | Addgene | #55756; deposited by Dr. Shankar Balasubramanian, the University of Cambridge | |
| Recombinant DNA reagent | pGW1-Dendra2-LC3 | (Tsvetkov et al., 2013b) | ||
| Recombinant DNA reagent | Httex1-Q46-Dendra2 | (Tsvetkov et al., 2013b) | ||
| Recombinant DNA reagent | pGW1-mito-Keima | other | It was cloned from the mt-mKeima/pIND(SP1) construct that we kindly received from Dr. Atsushi Miyawaki (RIKEN Brain Science Institute, Japan) | |
| Sequence-based reagent | ATG7, forward | Lone Star laboratories | 5’-TCCTGAGAGCATCCCTCTAATC-3’ | |
| Sequence-based reagent | ATG7, reverse | Lone Star laboratories | 5’- CTTCAGTTCGACACAGGTCATC-3’ | |
| Sequence-based reagent | TBP, forward | Lone Star laboratories | 5’-AGTGCCCAGCATCACTGTTT-3’ | |
| Sequence-based reagent | TBP, reverse | Lone Star laboratories | 5’-GGTCCATGACTCTCACTTTCTT-3’ | |
| Sequence-based reagent | ATG2700 | Dr. Monchaud lab. | ATTCTTGGGGCTGGGGTCCCT TGGGGAACTGTATTGGGTGAACC | |
| Sequence-based reagent | SS-DNA | Dr. Monchaud lab. | GCACGCGTATCTTTTTGGCGCAGGTG | |
| Commercial assay or kit | RNeasy Mini kit | Qiagen | 74104 | |
| Commercial assay or kit | iScript Reverse Transcription SuperMix | BioRad | 1708840 | |
| Chemical compound, drug | Pyridostatin (PDS) | Cayman Chemical | 18013 | |
| Chemical compound, drug |
10-(4′-(N-diethylamino)butyl)−2-chlorophenoxazine (10-NCP) | EMD Millipore | 925681–41 | |
| Chemical compound, drug | N-TASQ | (Laguerre et al., 2015; Laguerre et al., 2016) | synthesized by Dr. David Monchaud | |
| Software, algorithm | JMP software | SAS Institute, Houston, TX | ||
| Other | Hoechst dye | Santa Cruz Biotechnology | sc-394039 | |
| Other | poly-D-lysine | Millipore | A-003-E | |
| Other | Neurobasal Medium | Life Technologies | 21103–049 | |
| Other | B-27 | Life Technologies | 17504–044 | |
| Other | GlutaMAX | Life Technologies | 35050–061 | |
| Other | penicillin-streptomycin | Life Technologies | 15240.062 | |
| Other | HisPur Ni-NTA resin | Thermo Scientific | 88221 | |
| Other | Dynabeads | ThermoFisher Scientific | 10002D |