Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Rattus norvegicus) | Sprague Dawley | Charles River | RRID:MGI:5651135 | |
| Strain, strain background (Mus musculus) | FVB mice | Charles River | RRID:IMSR_CRL:207 | |
| Genetic reagent (Mus musculus) | P2ry1tm1Bh;P2ry1 KO | (Fabre et al., 1999) | RRID:MGI:3623279 | |
| Genetic reagent (Mus musculus) | Pax2-Cre | (Ohyama and Groves, 2004) | RRID:IMSR_RBRC09434 | |
| Genetic reagent (Mus musculus) | R26-lsl-GCaMP3 | (Paukert et al., 2014) | ||
| Genetic reagent (Mus musculus) | B6.Cg-Snap25tm3.1Hze/J; Snap25-T2A-GCaMP6s | Jackson Laboratory | RRID:IMSR_JAX:025111 | |
| Genetic reagent (Mus musculus) | TMEM16Afl/fl | (Schreiber et al., 2015) | ||
| Genetic reagent (Mus musculus) | Tecta-Cre | this paper | A mouseline with Cre expression limited primarily to the sensory epithelium. Cross to TdTomato line reveals sparse labeling of cells within the temporal bone and spiral ganglion neurons. | |
| Genetic reagent (Mus musculus) | P2ry1tm1(KOMP)Vlcg;P2ry1 LacZ | KOMP | RRID:IMSR_KOMP:VG12793-1-Vlcg | |
| Genetic reagent (Mus musculus) | B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J; Ai14; TdTomato | Jackson Laboratory | RRID:IMSR_JAX:007909 | |
| Antibody | Chicken polyclonal anti-beta-gal | Aves | Cat:BGL-1010;RRID:AB_2313508 | (1:4000) |
| Antibody | Rabbit polyclonal anti-Myosin-VIIa | Proteus Biosciences | Cat:25–6790; RRID:AB_2314838 | (1:500) |
| Antibody | Donkey anti-chicken Alexa Fluor 488 | Life Technologies | Cat:ab150073; RRID:AB_2636877 | (1:2000) |
| Antibody | Donkey anit-rabbit Alexa Fluor 546 | Jackson ImmunoResearch | Cat:711-165-152; RRID:AB_2307443 | (1:2000) |
| Sequence-based reagent | Primer: cccagttgagattggaaagtg (Snap25GC6s-com-s) | Jackson Laboratory | ||
| Sequence-based reagent | Primer: acttcgcacaggatccaaga (Snap25GC6s-mut-as) | Jackson Laboratory | ||
| Sequence-based reagent | Primer: ctggttttgttggaatcagc (Snap25GC6s-wt-as) | Jackson Laboratory | ||
| Sequence-based reagent | Primer: ccgtcaggacaattatcacc (P2ry1-com-as) | this paper | ||
| Sequence-based reagent | Primer: cctaccagccctcatcttct (P2ry1-wt-s) | this paper | ||
| Sequence-based reagent | Primer: cttctatcgccttcttgacg (P2ry1-KO-s) | this paper | ||
| Sequence-based reagent | Primer: gatggttgtggtgtgtctcg (Tecta-com-s) | this paper | ||
| Sequence-based reagent | Primer: cagtgatgagggaggaggtg (Tecta-wt-as) | this paper | ||
| Sequence-based reagent | Primer: cctgtccctgaacatgtcca (Tecta-Cre-as) | this paper | ||
| Sequence-based reagent | Primer: gctgcctgagttggaaagaa (P2ry1-LacZ-com-s) | this paper | ||
| Sequence-based reagent | Primer: ggcttcatgtggaaaacgaa
(P2ry1-LacZ-wt-as) |
this paper | ||
| Sequence-based reagent | Primer: ctctgctgcctcctggcttct (Rosa26-s) | Paukert et al., 2014 | ||
| Sequence-based reagent | Primer: cgaggcggatcacaagcaata (Rosa26-as) | Paukert et al., 2014 | ||
| Sequence-based reagent | Primer: tcaatgggcgggggtcgtt (CMV-E-as) | Paukert et al., 2014 | ||
| Sequence-based reagent | Primer: attcagacggcaaacgactg (P2ry1-LacZ-LacZ-as) | this paper | ||
| Sequence-based reagent | crRNA: TAATGATGAATAATTCATCC (Tecta exon two targeting) | this paper | ||
| Chemical compound, drug | BAPTA-AM | Sigma | Cat:A1076; CAS:126150-97-8 | (100 μM) |
| Chemical compound, drug | Thapsigargin | Sigma | Cat:T9033; CAS:67526-95-8 | (2 μM) |
| Chemical compound, drug | U73122 | Tocris | Cat:1268; CAS:112648-68-7 | (10 μM) |
| Chemical compound, drug | U73343 | Tocris | Cat:4133; CAS:142878-12-4 | (10 μM) |
| Chemical compound, drug | Ryanodine | Tocris | Cat: 1329; CAS:15662-33-6 | (10 μM) |
| Chemical compound, drug | MRS2500 | Tocris | Cat:2159; CAS:630103-23-0 | (1 μM) |
| Chemical compound, drug | PPADS | Sigma | Cat:P178; CAS:192575-19-2 (anhydrous) | (100 μM) |
| Chemical compound, drug | Suramin | Sigma | Cat:S2671; CAS:129-46-4 | (50 μM) |
| Chemical compound, drug | TTX | Abcam | Cat: ab120055; CAS: 18660-81-6 |
(1 μM) |
| Chemical compound, drug | Ouabain | Tocris | Cat: 1076; CAS: 630-60-4 | (10 μM) |
| Chemical compound, drug | Bumetanide | Tocris | Cat: 3108; CAS: 28395-03-1 | (50 μM) |
| Chemical compound, drug | CsCl2 | Sigma | Cat: C4036; CAS: 7647-17-8 | (100 μM) |
| Software, algorithm | ZEN Blue/Black | Zeiss | RRID:SCR_013672 | |
| Software, algorithm | ImageJ | https://imagej.nih.gov/ij/ | RRID:SCR_003070 | |
| Software, algorithm | MultiStackReg | http://bradbusse.net/sciencedownloads.html | RRID:SCR_016098 | |
| Software, algorithm | MATLAB 2017b | Mathworks | RRID:SCR_001622 | |
| Software, algorithm | CorelDRAW Graphics Suite | Corel | RRID:SCR_014235 | |
| Strain, strain background (Rattus norvegicus) | Sprague Dawley | Charles River | RRID:MGI:5651135 |