Table 3.

Ten differentially expressed conserved miRNAs that can specifically induced or silenced by exogenous nitric oxide, including the miRNA name, sequences, target gene or protein, and description of function.

miRNAs	Sequences	Target Gene or Protein	Description of Function	Reference
mtr-miR156a	tgacagaagagagagagcaca	SQUAMOSA promoter-binding-like protein (SPL) genes.	Anthocyanin biosynthesis; vegetative phase transition.	[30,36,37]
mtr-miR399a	tgccaaaggagatttgcccag	Phosphate transporter; high affinity inorganic phosphate transporter.	Pi uptake.	[38,39]
mtr-miR399c	tgccaaaggagatttg
mtr-miR399q	ccctgtgccaaaggagagctgctctt
mtr-miR5213-5p	tacgtgtgtcttcacctctgaa	Disease resistance protein.	Response to salt/alkali stress.	[40,41]
mtr-miR5752a	cattgtttggtttagtacaaa	Starch synthase; amino acid binding; metal ion binding.	Starch, galactolipid, amylopectin biosynthetic; response to hypoxia; regulation of ethylene-activated; metabolic process; metal ion transport.	[42]
mtr-miR7696a-5p	tcaagttctcataattcaaaa	Chitin binding; protein kinase.	Innate immune response; protein phosphorylation; cell wall macromolecule catabolic.	[43]
mtr-miR398a-5p	ggagtgacactgagaacacaag	Cu/Zn-superoxide dismutase copper chaperone.	Defense against reactive oxygen toxicity.	[44]
mtr-miR5232	tacatgtcgctctcacctgaa	Glycoside hydrolase; type IIB calcium ATPase protein kinase.	Participate in metabolism.	[41]
mtr-miR5559-5p	tacttggtgaattgttggatc	inorganic diphosphatase magnesium ion binding.	Response to cadmium ion; phosphate-containing compound metabolic.	[29]