KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Anti-human IFN-γ (ELISA, capture) | BD Biosciences | CAT#551221, RRID: AB_394099 |
| Anti-human IFN-γ (ELISA, detection) | BD Biosciences | CAT#554550, RRID: AB_395472 |
| Anti-human IL-4 (ELISA, capture) | BD Biosciences | CAT#554515; RRID: AB_398567 |
| Anti-human IL-4 (ELISA, detection) | BD Biosciences | CAT#554483; RRID: AB_395422 |
| Anti-human IL-2 (ELISA, capture) | BD Biosciences | CAT#554563; RRID: AB_398570 |
| Anti-human IL-2 (ELISA, detection) | BD Biosciences | CAT#555040; RRID: AB_395666 |
| Anti-human CD3 (Clone HIT3a; LEAF purified) | Biolegend | CAT#300314, RRID: AB_314050 |
| Anti-human CD28 (Clone CD28.2; LEAF purified) | Biolegend | CAT#302902, RRID: AB_314304 |
| Anti-human CD45 (Clone H130) | Biolegend | CAT#304026, RFID: AB_893337 |
| Anti-human TCR(alpha)(beta) (Clone I26) | Biolegend | CAT#306716, RRID: AB_1953257 |
| Anti-human CD4 (Clone OKT4) | Biolegend | CAT#317414, RRID: AB_571959 |
| Anti-human CD8 (Clone SK1) | Biolegend | CAT#344714, RRID: AB_2044006 |
| Anti-human CD45RO (Clone UCHL1) | Biolegend | CAT#304216, RRID: AB_493659 |
| Anti-human CD45RA (Clone HI100) | Biolegend | CAT#304126, RRID: AB_10708879 |
| Anti-human CD161 (Clone HP-3G10) | Biolegend | CAT#339928, RRID: AB_2563967 |
| Anti-human CD69 (Clone FN50) | Biolegend | CAT#310914, RRID: AB_314849 |
| Anti-human CD56 (Clone HCD56) | Biolegend | CAT#318304, RRID: AB_604100 |
| Anti-human CD62L (Clone DREG-56) | Biolegend | CAT#304822, RRID: AB_830801 |
| Anti-human CD14 (Clone HCD14) | Biolegend | CAT#325608, RRID: AB_830681 |
| Anti-human CD11b (Clone ICRF44) | Biolegend | CAT#301330, RRID: AB_2561703 |
| Anti-human CD11c (Clone N418) | Biolegend | CAT#337234, RRID: AB_2566656 |
| Anti-human CD20 (Clone 2H7) | Biolegend | CAT#555623, RRID: AB_395989 |
| Anti-human HLA-A2 (Clone BB7.2) | Biolegend | CAT#558570, RRID: AB_647220 |
| Anti-human CD1d (Clone 51.1) | Biolegend | CAT#350308, RRID: AB_10642829 |
| Anti-human PD-1 (Clone EH12.2H7) | Biolegend | CAT#329908, RRID: AB_940475 |
| Anti-human CCR4 (Clone L291H4) | Biolegend | CAT#359409, RRID: AB_2562430 |
| Anti-human CCR5 (Clone HEK/1/85a) | Biolegend | CAT#313705, RRID: AB_345305 |
| Anti-human CXCR3 (Clone G025H7) | Biolegend | CAT#306513, RRID: AB_2089652 |
| Anti-human NKG2D (Clone 1D11) | Biolegend | CAT#320812, RRID: AB_2234394 |
| Anti-human IFNγ (Clone B27) | Biolegend | CAT#506518, RRID: AB_2123321 |
| Anti-human Granzyme B (Clone QA16A02) | Biolegend | CAT#372204, RRID: AB_2687028 |
| Anti-human Perforin (Clone dG9) | Biolegend | CAT#308126, RRID: AB_2572049 |
| Anti-human TNFα (Clone Mab11) | Biolegend | CAT#502912, RRID: AB_315264 |
| Anti-human IL-2 (Clone MQ1–17H12) | Biolegend | CAT#500341, RRID: AB_2562854 |
| Anti-human IL-4 (Clone MP4–25D2) | Biolegend | CAT#500812, RRID: AB_315131 |
| Anti-human IL-17 (Clone BL168) | Biolegend | CAT#512334, RRID: AB_2563986 |
| Anti-human CD34 (Clone 581) | BD Biosciences | CAT#555822, RRID: AB_396151 |
| Anti-human TCR V(alpha)24-J(alpha)18 (Clone 6B11) | BD Biosciences | CAT#552825, RRID: AB_394478 |
| Anti-human TCR V(beta)11 | Beckman-Coulter | CAT#A66905 |
| Anti-human PLZF (Clone 9E12) | eBioscience | CAT#19-9322-82, RRID: AB_2637113 |
| Anti-human T-bet (Clone 4B10) | eBioscience | CAT#25-5825-80, RRID: AB_11041809 |
| Anti-mouse CD1d (Clone 1B1) | eBioscience | CAT#17-0011-82, RRID: AB_2573135 |
| Mouse lgG2b, κ isotype control antibody (Clone MPC-11) | Biolegend | CAT#400320 |
| Rat lgG2b, κ isotype control antibody (Clone eB149/10H5) | eBioscience | CAT#17-4031-82, RRID: AB_470176 |
| Human Fc Receptor Blocking Solution (TrueStain FcX) | Biolegend | CAT#422302 |
| Mouse Fc Block (anti-mouse CD16/32) | BD Biosciences | CAT#553142, RRID: AB_394657 |
| Anti-human CD1d antibody (Clone 51.1; LEAF purified) | Biolegend | CAT#350304, RRID: AB_10641291 |
| Mouse lgG2b, κ isotype control antibody (Clone MG2b-57; LEAF purified) | Biolegend | CAT#401212 |
| Tetramer/Dextramer | ||
| hCD1d/PBS-57 tetramer | NIH Tetramer Core Facility | N/A |
| HLA-A2/NY-ES0–1157–165 dextramer | This paper | N/A |
| Bacterial and Virus Strains | ||
| Lenti/iNKT | This paper | N/A |
| Lenti/iNKT-EGFP | This paper | N/A |
| Lenti/iNKT-sr39TK | This paper | N/A |
| Lenti/FG | This paper | N/A |
| Lenti/CD1d | This paper | N/A |
| Lenti/IL-15-FG | This paper | N/A |
| Lenti/ESO-sr39TK | This paper | N/A |
| Lenti/HLA-A2 | This paper | N/A |
| Lenti/NY-ESO-1 | This paper | N/A |
| Biological Samples | ||
| Human peripheral blood mononuclear cells (PBMCs) | UCLA | N/A |
| Human fetal liver | UCLA | N/A |
| Human cord blood CD34+ hematopoietic stem and progenitor cells (CB HSCs) | UCLA | N/A |
| Fetal thymus tissues | UCLA | N/A |
| Postnatal human thymus | CHLA | N/A |
| G-CSF-mobilized peripheral blood units | CCHMC | CAT#M001F-GCSF-3 |
| G-CSF-mobilized leukopak | HemaCare | CAT#M001CLPG-4-KIT |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Streptavidin-HRP conjugate | Invitrogen | CAT#SA10001 |
| Recombinant IL-2 (ELISA, standard) | eBioscience | CAT#570409 |
| Recombinant human IL-4 (ELISA, standard) | eBioscience | CAT#571809 |
| Recombinant human IL-17 (ELISA, standard) | eBioscience | CAT#570509 |
| Recombinant human IFN-γ (ELISA, standard) | eBioscience | CAT#570209 |
| Tetramethylbenzidine (TMB) | KPL | CAT#5120–0053 |
| Ganciclovir (GCV) | Sigma | CAT#ADV465749843 |
| α-Galactosylceramide (KRN7000) | Avanti Polar Lipids | SKU#867000P-1mg |
| Recombinant human IL-2 | Peprotech | CAT#200–02 |
| Recombinant human IL-3 | Peprotech | CAT#200–03 |
| Recombinant human IL-4 | Peprotech | CAT#200–04 |
| Recombinant human IL-7 | Peprotech | CAT#200–07 |
| Recombinant human IL-15 | Peprotech | CAT#200–15 |
| Recombinant human Flt3-Ligand | Peprotech | CAT#300–19 |
| Recombinant human SCF | Peprotech | CAT#300–07 |
| Human NY-ESO-1157–165 peptide | ThermoFisher | N/A |
| Recombinant human TPO | Peprotech | CAT#300–18 |
| Recombinant human GM-CSF | Peprotech | CAT#300–03 |
| X-VIVO 15 Serum-free Hematopoietic Cell Medium | Lonza | CAT#04–418Q |
| RPMI1640 cell culture medium | Corning Cellgro | CAT#10–040-CV |
| DMEM cell culture medium | Corning Cellgro | CAT#10–013-CV |
| Fetal Bovine Serum (FBS) | Sigma | CAT#F2442 |
| Penicillin-Streptomycine-Glutamine (P/S/G) | Gibco | CAT#10378016 |
| MEM non-essential amino acids (NEAA) | Gibco | CAT#11140050 |
| HEPES Buffer Solution | Gibco | CAT#15630056 |
| Sodium Pyruvate | Gibco | CAT#11360070 |
| Beta-Mercaptoethanol | Sigma | SKU#M6250 |
| Normocin | Invivogen | CAT#ant-nr-2 |
| Fixable Viability Dye eFluor506 | affymetrix eBioscience | CAT#65-0866-14 |
| Cell Fixation/Permeabilization Kit | BD Biosciences | CAT#554714 |
| RetroNectin recombination human fibronectin fragment, 2.5mg | Takara | CAT#T100B |
| 10% neutral-buffered formalin | Richard-Allan Scientific | CAT#5705 |
| D-Luciferin | Caliper Life Science | CAT#XR-1001 |
| Isoflurane | Zoetis | CAT#50019100 |
| Phosphate Buffered Saline (PBS) pH 7.4 (1X) | Gibco | CAT#10010–023 |
| Phorbol-12-myristate-13-acetate (PMA) | Calbiochem | CAT#524400 |
| lonomycin, Calcium salt, Streptomyces conglobatus | Calbiochem | CAT#407952 |
| Critical Commercial Assays | ||
| IOTest beta Mark TCR Vβ Repertoire Kit | Beckman-Coulter | CAT#IM3497 |
| OneStep RT-PCR kit | Qiagen | CAT#210212 |
| NK Cell Isolation Kit | Miltenyi Biotec | CAT#130-092-657 |
| Human CD14 Microbeads | Miltenyi Biotec | CAT# 130-050-201 |
| Fixation/Permeabilization Solution Kit | BD Sciences | CAT#55474 |
| Human IL-17A ELISA MAX Deluxe Kit | Biolegend | CAT#433915 |
| Deposited Data | ||
| N/A | ||
| Experimental Models: Cell Lines | ||
| Human multiple myeloma (MM) cell line MM.1S | ATCC | CRL-2974 |
| Human chronic myelogenous leukemia cancer cell line K562 | ATCC | CCL-243 |
| Human melanoma cell line A375 | ATCC | CRL-1619 |
| Human multiple myeloma (MM) cell line MM.1S-FG | This paper | N/A |
| Human multiple myeloma (MM) cell line MM.1S-hCD1d-FG | This paper | N/A |
| Human chronic myelogenous leukemia cancer cell line K562-FG | This paper | N/A |
| Human melanoma cell line A375-hlL-15-FG | This paper | N/A |
| Human melanoma cell line A375-hlL-15-hCD1d-FG | This paper | N/A |
| Human melanoma cell line A375-A2-ESO-FG | This paper | N/A |
| Experimental Models: Organisms/Strains | ||
| NOD.Cg-Prkdcscid II2rgtm1Wjl/SzJ | The Jackson Laboratory | Stock #: 005557 |
| Human bone marrow-liver-thymus (BLT) engrafted NSG mice | This paper | N/A |
| Human iNKT TCR gene-engineered bone marrow-liver-thymus (BLT) mice | This paper | N/A |
| Secondary BLT-iNKT mice | This paper | N/A |
| BLT-iNKT mice generated using Lenti/iNKT-sr39TK vector-transduced PBMCs | This paper | N/A |
| Oligonucleotides | ||
| Primer: TCRα Forward: GCTCTCTGCACATCACAGCCTCCCAG | IDT | N/A |
| Primer: TCRβ Forward: CCACAGAGAAGGGAGATCTTTCCTCTGAGTC | IDT | N/A |
| Recombinant DNA | ||
| Vector: parental lentivector pMNDW | Giannoni et al., 2013 and Lan et al.,2006 | N/A |
| Software and Algorithms | ||
| FlowJo Software | FlowJo | https://www.flowio.com/solutions/flowio/downloads |
| OsiriX Imaging Software | OsiriX | https://www.osirix-viewer.com/ |
| Living Imaging 2.50 software | Xenogen/PerkinElmer | http://www.Derkinelmer.com/lab-croducts-and-services/resources/in-vivo-imaqinq-software-downloads.html |
| Prism 6 | Graphpad | https://www.ararjhrjad.com/scientific-software/orism/ |
| I-control 1.7 Microplate Reader Software | Tecan | https://www.selectscience.net/tecan/i-control-microplate-reader-software/81307 |