Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used in real-time polymerase chain reaction.
| Probe and primers | Sequence |
|---|---|
| Probe:HEX APMV1-LNA | (5′ HEX-gggaCrGChTgCtatCc-BHQ3′) |
| Primer forward:APMV1F | (5′AGTGATGTGCTCGGACCTTC3′) |
| Primer reverse:APMV1R | (5′ CCTGAGGAGAGGCATTTGCTA 3′) |
APMV1=Avian paramyxovirus 1
