Skip to main content
. 2020 Jan 29;9:e51493. doi: 10.7554/eLife.51493

Key resources table.

Reagent type
(species) or
resource
Designation Source or
reference
Identifiers Additional
information
Strain, strain background (Drosophila melanogaster) Wolbachia-free Drosophila melanogaster Canton-S BloomingtonDrosophilaStock Center BL64349
Strain, strain background (Escherichia coli) BW29427 Carol Gross lab pir+ DAP- host strain thrB1004, pro, thi, rpsL, hsdS, lacZDM15, RP4-1360 ∆(araBAD) 567 ∆dapA1341::[erm pir+], donor for conjugation with Acetobacter pasteurianus
Strain, strain background (Lactobacillus plantarum) Lp (Obadia et al., 2017) Lactobacillus plantarum (WF) wild fly (D. melanogaster) isolate
Strain, strain background (Lactobacillus brevis) Lb (Obadia et al., 2017) Lactobacillus brevis lab fly (Oregon-R) isolate
Strain, strain background (Acetobacter pasteurianus) Ap (Gould et al., 2018) Acetobacter pasteurianus lab fly (Oregon-R) isolate
Strain, strain background (Acetobacter tropicalis) At (Gould et al., 2018) Acetobacter tropicalis lab fly (Oregon-R) isolate
Strain, strain background (Acetobacter orientalis) Ao (Obadia et al., 2017) Acetobacter orientalis lab fly (Oregon-R) isolate
Strain, strain background (Acetobacter indonesiensis) Ai (Obadia et al., 2017) Acetobacter indonesiensis lab fly isolate
Strain, strain background (Acetobacter aceti) Aa (Obadia et al., 2017) Acetobacter aceti lab fly isolate
Strain, strain background (Lactobacillus plantarum) Lp mCherry (Obadia et al., 2017) Lactobacillus plantarum (WF) wild fly isolate pCD256-P11-mCherry
Strain, strain background (Lactobacillus plantarum) LppH This study Lactobacillus plantarum (WF) wild fly isolate pCD256-P11-pHluorin
Strain, strain background (Acetobacter pasteurianus) Ap GFP This study Acetobacter pasteurianus lab fly (Oregon-R) isolate pCM62-Plac-sfGFP
Recombinant DNA reagent pCM62 (plasmid) (Marx and Lidstrom, 2001) Plasmid to clone sfGFP under the control of the Escherichia coli lac promoter
Recombinant DNA reagent pCD256-mCherry (plasmid) (Spath et al., 2012a) Backbone for pHluorin expression
Recombinant DNA reagent pBad-sfGFP (plasmid) Addgene RRID:Addgene_85482 Source of sfGFP
Recombinant DNA reagent pZS11-pHluorin (Mitosch et al., 2017) Source of pHluorin
Sequence-based reagent ZTG109 This study PCR primers ggatttatgcATGAGCAAGGGCGAGGAG
Sequence-based reagent ZTG110 This study PCR primers gctttgttagcagccggatcgggcccggatctcgagTTACTTGTACAGCTCGTCCATG
Sequence-based reagent ZFH064-pHluorin This study PCR primers ATTACAAGGAGATTTTACAT ATGAGTAAAGGAGAAGAACTTTTC
Sequence-based reagent ZFH065-pHluorin This study PCR primers gtctcggacagcggttttGGATCCTTATTTGTATAGTTCATCCATG
Commercial assay or kit Cell Viability Kit BD 349483
Commercial assay or kit EnzyChrom L-lactate Assay Kit BioAssay Systems ECLC-100, Lots BH06A30 and BI07A09
Commercial assay or kit EnzyChrom D-lactate Assay Kit BioAssay Systems EDLC-100, Lots BH0420 and BI09A07
Chemical compound, drug D-mannitol ACROS Organics AC125345000, Lot A0292699
Chemical compound, drug lactate Sigma L6661-100ML Lot MKCC6092
Chemical compound, drug Tween 80 ACROS Organics AC278632500 Lot A0375189
Chemical compound, drug NaOH EMD Millipore SX0590, Lot B0484969043
Chemical compound, drug HCl Fisher Chemical A144-500, Lot 166315
Chemical compound, drug ampicillin MP Biomedicals 02194526, Lot R25707
Chemical compound, drug streptomycin Sigma S9137 Lot SLBN3225V
Chemical compound, drug chloramphenicol Calbiochem 220551, Lot D00083225
Chemical compound, drug tetracycline MP Biomedicals 02103011, Lot 2297K
Chemical compound, drug erythromycin Sigma E5389-1G, Lot WXBC4044V
Chemical compound, drug ciprofloxacin Sigma-Aldrich 17850, Lot 116M4062CV
Chemical compound, drug trimethoprim Alfa Aesar J63053-03, Lot T16A009
Chemical compound, drug spectinomycin Sigma-Aldrich PHR1426-500MG, Lot LRAA9208
Chemical compound, drug rifampin Sigma R3501-5G, Lot SLBP9440V
Chemical compound, drug vancomycin Sigma-Aldrich PHR1732−4 × 250 MG, Lot LRAB3620
Chemical compound, drug BCECF Invitrogen B1151, Lot 1831845
Chemical compound, drug DMSO Fisher BioReagents BP231, Lot 165487
Software, algorithm MATLAB Mathworks RRID:SCR_01622 R2018a
Software, algorithm µManager (Edelstein et al., 2010) RRID:SCR_016865 v. 1.4
Software, algorithm Morphometrics (Ursell et al., 2017)
Software, algorithm SuperSegger (Stylianidou et al., 2016) v. 3
Other MRS medium BD 288110
Other yeast extract Research Products International Y20020, Lot 30553
Other peptone BD 211677 Lot 7065816
Other agar BD 214530
Other PBS Gibco 70011044 (10X, pH 7.4)