Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Drosophila melanogaster) | Wolbachia-free Drosophila melanogaster Canton-S | BloomingtonDrosophilaStock Center | BL64349 | |
| Strain, strain background (Escherichia coli) | BW29427 | Carol Gross lab | pir+ DAP- host strain thrB1004, pro, thi, rpsL, hsdS, lacZDM15, RP4-1360 ∆(araBAD) 567 ∆dapA1341::[erm pir+], donor for conjugation with Acetobacter pasteurianus | |
| Strain, strain background (Lactobacillus plantarum) | Lp | (Obadia et al., 2017) | Lactobacillus plantarum (WF) wild fly (D. melanogaster) isolate | |
| Strain, strain background (Lactobacillus brevis) | Lb | (Obadia et al., 2017) | Lactobacillus brevis lab fly (Oregon-R) isolate | |
| Strain, strain background (Acetobacter pasteurianus) | Ap | (Gould et al., 2018) | Acetobacter pasteurianus lab fly (Oregon-R) isolate | |
| Strain, strain background (Acetobacter tropicalis) | At | (Gould et al., 2018) | Acetobacter tropicalis lab fly (Oregon-R) isolate | |
| Strain, strain background (Acetobacter orientalis) | Ao | (Obadia et al., 2017) | Acetobacter orientalis lab fly (Oregon-R) isolate | |
| Strain, strain background (Acetobacter indonesiensis) | Ai | (Obadia et al., 2017) | Acetobacter indonesiensis lab fly isolate | |
| Strain, strain background (Acetobacter aceti) | Aa | (Obadia et al., 2017) | Acetobacter aceti lab fly isolate | |
| Strain, strain background (Lactobacillus plantarum) | Lp mCherry | (Obadia et al., 2017) | Lactobacillus plantarum (WF) wild fly isolate pCD256-P11-mCherry | |
| Strain, strain background (Lactobacillus plantarum) | LppH | This study | Lactobacillus plantarum (WF) wild fly isolate pCD256-P11-pHluorin | |
| Strain, strain background (Acetobacter pasteurianus) | Ap GFP | This study | Acetobacter pasteurianus lab fly (Oregon-R) isolate pCM62-Plac-sfGFP | |
| Recombinant DNA reagent | pCM62 (plasmid) | (Marx and Lidstrom, 2001) | Plasmid to clone sfGFP under the control of the Escherichia coli lac promoter | |
| Recombinant DNA reagent | pCD256-mCherry (plasmid) | (Spath et al., 2012a) | Backbone for pHluorin expression | |
| Recombinant DNA reagent | pBad-sfGFP (plasmid) | Addgene | RRID:Addgene_85482 | Source of sfGFP |
| Recombinant DNA reagent | pZS11-pHluorin | (Mitosch et al., 2017) | Source of pHluorin | |
| Sequence-based reagent | ZTG109 | This study | PCR primers | ggatttatgcATGAGCAAGGGCGAGGAG |
| Sequence-based reagent | ZTG110 | This study | PCR primers | gctttgttagcagccggatcgggcccggatctcgagTTACTTGTACAGCTCGTCCATG |
| Sequence-based reagent | ZFH064-pHluorin | This study | PCR primers | ATTACAAGGAGATTTTACAT ATGAGTAAAGGAGAAGAACTTTTC |
| Sequence-based reagent | ZFH065-pHluorin | This study | PCR primers | gtctcggacagcggttttGGATCCTTATTTGTATAGTTCATCCATG |
| Commercial assay or kit | Cell Viability Kit | BD | 349483 | |
| Commercial assay or kit | EnzyChrom L-lactate Assay Kit | BioAssay Systems | ECLC-100, Lots BH06A30 and BI07A09 | |
| Commercial assay or kit | EnzyChrom D-lactate Assay Kit | BioAssay Systems | EDLC-100, Lots BH0420 and BI09A07 | |
| Chemical compound, drug | D-mannitol | ACROS Organics | AC125345000, Lot A0292699 | |
| Chemical compound, drug | lactate | Sigma | L6661-100ML Lot MKCC6092 | |
| Chemical compound, drug | Tween 80 | ACROS Organics | AC278632500 Lot A0375189 | |
| Chemical compound, drug | NaOH | EMD Millipore | SX0590, Lot B0484969043 | |
| Chemical compound, drug | HCl | Fisher Chemical | A144-500, Lot 166315 | |
| Chemical compound, drug | ampicillin | MP Biomedicals | 02194526, Lot R25707 | |
| Chemical compound, drug | streptomycin | Sigma | S9137 Lot SLBN3225V | |
| Chemical compound, drug | chloramphenicol | Calbiochem | 220551, Lot D00083225 | |
| Chemical compound, drug | tetracycline | MP Biomedicals | 02103011, Lot 2297K | |
| Chemical compound, drug | erythromycin | Sigma | E5389-1G, Lot WXBC4044V | |
| Chemical compound, drug | ciprofloxacin | Sigma-Aldrich | 17850, Lot 116M4062CV | |
| Chemical compound, drug | trimethoprim | Alfa Aesar | J63053-03, Lot T16A009 | |
| Chemical compound, drug | spectinomycin | Sigma-Aldrich | PHR1426-500MG, Lot LRAA9208 | |
| Chemical compound, drug | rifampin | Sigma | R3501-5G, Lot SLBP9440V | |
| Chemical compound, drug | vancomycin | Sigma-Aldrich | PHR1732−4 × 250 MG, Lot LRAB3620 | |
| Chemical compound, drug | BCECF | Invitrogen | B1151, Lot 1831845 | |
| Chemical compound, drug | DMSO | Fisher BioReagents | BP231, Lot 165487 | |
| Software, algorithm | MATLAB | Mathworks | RRID:SCR_01622 | R2018a |
| Software, algorithm | µManager | (Edelstein et al., 2010) | RRID:SCR_016865 | v. 1.4 |
| Software, algorithm | Morphometrics | (Ursell et al., 2017) | ||
| Software, algorithm | SuperSegger | (Stylianidou et al., 2016) | v. 3 | |
| Other | MRS medium | BD | 288110 | |
| Other | yeast extract | Research Products International | Y20020, Lot 30553 | |
| Other | peptone | BD | 211677 Lot 7065816 | |
| Other | agar | BD | 214530 | |
| Other | PBS | Gibco | 70011044 | (10X, pH 7.4) |