Skip to main content
. 2020 Feb 18;9:e50845. doi: 10.7554/eLife.50845

Key resources table.

Reagent type
(species) or resource
Designation Source or reference Identifiers Additional
information
Strain, strain background (Eggerthella lenta) Eggerthella lenta strains REF 37 El See Supplementary file 1d
Strain, strain background (Eggerthella sinensis) Eggerthella sinensis DSM16107 REF 37 Es See Supplementary file 1d
Strain, strain background (Gordonibacter) Gordonibactr strains REF 37 Gp, Gs See Supplementary file 1d
Strain, strain background (Paraeggerthella) Paraeggerthella hongkongensis REF 37 Ph See Supplementary file 1d
Strain, strain background (Eschericia coli) Eschericia coli MG1655 Palmer lab, Newcastle University See Supplementary file 1d
Strain, strain background (Bacteroides fragilis ATCC 25285) Bacteroides fragilis ATCC 25285 ATCC See Supplementary file 1d
Strain, strain background (Clostridium sporogenes ATCC 15579) Clostridium sporogenes ATCC 15579 ATCC See Supplementary file 1d
Strain, strain background (Enterococcus faecalis OG1RF) Enterococcus faecalis OG1RF ATCC See Supplementary file 1d
Strain, strain background (Edwarsiella tarda ATCC 23685) Edwarsiella tarda ATCC 23685 ATCC See Supplementary file 1d
Sequence-based reagent qPCR primers dadh REF 9 PCR primers GAGATCTGGTCCACCGTCAT and AGTGGAAGTACACCGGGATG
Sequence-based reagent qPCR primers E. lenta REF 10 PCR primers CAGCAGGGAAGAAATTCGAC and TTGAGCCCTCGGATTAGAGA
Sequence-based reagent qPCR primers dodh This work PCR primers GFP version of pLKO.1-Puro
Sequence-based reagent Primers for full length dadh REF 9 PCR primers ATGGGTAACCTGACCATG and TTACTCCCTCCCTTCGTA
Sequence-based reagent Sequencing primers SNP506 in dadh REF 9 PCR primers GGGGTGTCCATGTTGCCGGT and ACCGGCTACGGCAACGGC
Commercial assay or kit DNeasy UltraClean Microbial Kit Qiagen, catalog Cat # 12224–50 Extraction of gDNA from bacterial cultures
Chemical compound, drug Dopamine hydrochloride Sigma-Aldrich Cat# PHR1090-1G
Chemical compound, drug (+)-catechin hydrate Millipore Sigma Cat# C1251-5G
Chemical compound, drug 3,4-dihydroxyphenylacetic acid (DOPAC) Millipore Sigma Cat# 850217–1G
Chemical compound, drug 3,4-dihydroxyphenylpropionic acid (Hydrocaffeic acid) Millipore Sigma Cat# 102601–10G
Other LC-MS/MS Agilent Agilent:6410 Triple Quad LC/MS
Other Anaerobic chambers Coy Laboratory products
Chemical compound, drug BBL Brain Heart Infusion (BHI) media Beckton Dickinson Cat# L007440
Chemical compound, drug L-arginine Sigma-Aldrich Cat# A5006-100G
Chemical compound, drug benzyl viologen Sigma-Aldrich Cat# 271845–250 mg
Chemical compound, drug methyl viologen Sigma-Aldrich Cat# 856177–1 g
Chemical compound, drug sodium dithionite Sigma-Aldrich Cat# 157953–5G
Chemical compound, drug diquat Sigma-Aldrich Cat# 45422–250 mg
Chemical compound, drug 3,4-dihydroxyphenylacetic acid (ring-d3, 2,2-d2, 98%) Cambridge Isotope Laboratories Cat# DLM-2499–0.01
Chemical compound, drug dopamine HCl (1,1,2,2-d4, 97–98%) Cambridge Isotope Laboratories Cat# DLM-2498–0.1