REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Rabbit polyclonal anti-Pcgf1	Scelfo et al., 2019	N/A
Rabbit polyclonal anti-Pcgf2	Scelfo et al., 2019	N/A
Rabbit polyclonal anti-Pcgf6	Scelfo et al., 2019	N/A
Rabbit polyclonal anti-Ring1b	Chiacchiera et al., 2016a	N/A
Mouse monoclonal anti-Vinculin	Merck (Sigma Aldrich)	Cat# V9131; RRID: AB_477629
Rabbit polyclonal anti-DEDAF (RYBP)	Merck (Sigma Aldrich)	Cat# AB3637; RRID: AB_2285466
Rabbit polyclonal anti-Cbx7	Abcam	Cat# ab21873; RRID: AB_726005
Rabbit monoclonal anti-Suz12 (D39F6)	Cell Signaling Technology	Cat# 3737; RRID: AB_2196850
Rabbit monoclonal anti-tri-methyl-histone H3 (Lys27) (C36B11)	Cell Signaling Technology	Cat# 9733; RRID: AB_2616029
Rabbit monoclonal anti-ubiquityl histone H2A (Lys119) (D27C4)	Cell Signaling Technology	Cat# 8240; RRID: AB_10891618
Rabbit monoclonal anti-Bap1 (D7W70)	Cell Signaling Technology	Cat# 13271; RRID: AB_2798168
Mouse monoclonal anti-H3K27me1	Active Motif	Cat# 61015; RRID: AB_2715573
Rabbit monoclonal anti-di-methyl-histone H3 (Lys27) (D18C8)	Cell Signaling Technology	Cat# 9728; RRID: AB_1281338
Mouse monoclonal anti-Eed	Bracken et al., 2003	N/A
Mouse monoclonal anti-Ezh2	Pasini et al., 2004	N/A
Rabbit monoclonal anti-histone H3	Abcam	Cat# ab1791; RRID: AB_302613
Rabbit polyclonal anti-histone H2A (acidic patch)	Merck (Sigma Aldrich)	Cat# 07-146; RRID: AB_310394
Rabbit polyclonal anti-Mtf2	Proteintech	Cat# 16208-1-AP; RRID: AB_2147370
Rabbit monoclonal anti-Jarid2 (D6M9X)	Cell Signaling Technology	Cat# 13594; RRID: AB_2798269
Goat polyclonal anti-Lamin B (M-20)	Santa Cruz Biotechnology	Cat# sc-6217; RRID: AB_648158
Rabbit polyclonal anti-C17orf96 (EPOP)	Active Motif	Cat# 61753; RRID: AB_2793758
Rabbit monoclonal anti-AEBP2 (D7C6X)	Cell Signaling Technology	Cat# 14129; RRID: AB_2798398
Rabbit monoclonal anti-HA (12CA5)	Pasini laboratory	N/A
Goat polyclonal anti-Suz12 (P-15)	Santa Cruz Biotechnology	Cat# sc-46264; RRID: AB_2196857
Mouse monoclonal anti-Actin (AC-40)	Merck (Sigma Aldrich)	Cat# A3853; RRID: AB_262137
Rabbit IgG Control Antibody	Merck (Sigma Aldrich)	Cat# I5006; RRID: AB_1163659
Anti-FLAG M2 affinity gel	Merck (Sigma Aldrich)	Cat# A2220; RRID: AB_10063035
Bacterial and Virus Strains
One Shot™ TOP10 Chemically Competent E. coli	Thermo Fisher Scientific (Invitrogen)	Cat# C404010
One Shot™ Stbl3™ Chemically Competent E. coli	Thermo Fisher Scientific (Invitrogen)	Cat# C737303
One Shot™ BL21(DE3) Chemically Competent E. coli	Thermo Fisher Scientific (Invitrogen)	Cat# C600003
Chemicals, Peptides, and Recombinant Proteins
Leukemia Inhibitory Factor	Pasini laboratory	N/A
CHIR-99021	Aurogen	Cat# S1263
PD-0325901	Aurogen	Cat# S1036
Lipofectamine 2000 Transfection Reagent	Thermo Fisher Scientific (Invitrogen)	Cat# 11668027
IGEPAL CA-630	Merck (Sigma Aldrich)	Cat# I8896
3X FLAG Peptide	Merck (Millipore)	Cat# F4799
Ethylene glycol-bis(succinic acid N-hydroxysuccinimide ester)	Merck (Sigma Aldrich)	Cat# E3257
Critical Commercial Assays
Agilent High Sensitivity DNA kit	Agilent	Cat# 5067-4626
QIAquick PCR purification kit	Qiagen	Cat# 28104
Quick-RNA™ MiniPrep extraction kit	Zymo Research	Cat# R1055
Deposited Data
Raw files	This paper	GEO: GSE134053
Mouse reference genome NCBI build 38, GRCm38	Genome Reference Consortium	https://www.ncbi.nlm.nih.gov/grc/mouse
Drosophila reference genome Release 6 plus ISO1 mitochondrial genome	The FlyBase Consortium/Berkeley Drosophila Genome Project/Celera Genomics	https://www.ncbi.nlm.nih.gov/assembly/GCF_000001215.4/
Western Blot	This paper	https://doi.org/10.17632/x6k27wtknb.2
Experimental Models: Cell Lines
Mouse: Parental: ES cell line ROSA26:creERT2 RING1A-/-; RING1Bfl/fl	Endoh et al., 2008	N/A Strain of origin 129P2/Ola
Mouse: ES cell line E14	Pasini laboratory	N/A Strain of origin 129P2/Ola
Mouse: RING1B WT: ES cell line ROSA26:creERT2 RING1A-/-; RING1Bfl/fl; RING1B WT	This paper	N/A Strain of origin 129P2/Ola
Mouse: RING1B 153S: ES cell line ROSA26:creERT2 RING1A-/-; RING1Bfl/fl; RING1B I53S	This paper	N/A Strain of origin 129P2/Ola
Mouse: EED fl/fl clone#1: ES cell line ROSA26:creERT2 EED fl/fl	This paper	N/A Strain of origin 129P2/Ola
Mouse: EED fl/fl clone#4: ES cell line ROSA26:creERT2 EED fl/fl	This paper	N/A Strain of origin 129P2/Ola
Mouse: Parental MTF2 KO: ES cell line ROSA26:creERT2 RING1A-/-; RING1Bfl/fl; MTF2-/-	This paper	N/A Strain of origin 129P2/Ola
Mouse: RING1B WT MTF2 KO: ES cell line ROSA26:creERT2 RING1A-/-; RING1Bfl/fl; RING1B WT; MTF2-/-	This paper	N/A Strain of origin 129P2/Ola
Mouse: RING1B I53S MTF2 KO: ES cell line ROSA26:creERT2 RING1A-/-; RING1Bfl/fl; RING1B I53S; MTF2-/-	This paper	N/A Strain of origin 129P2/Ola
Mouse: Ezh2 KO Ezh1 KO: ES cell line EZH2-/-;EZH1-/-	Lavarone et al., 2019	N/A Strain of origin 129P2/Ola
Drosophila S2 cell line	ATCC	ATCC CRL- 1963
Oligonucleotides
gRNA targeting Mtf2 exon 4 Forward: CACCGATGGTTATATGTGATAAGTG	This paper	N/A
gRNA targeting Mtf2 exon 4 Reverse: AAACCACTTATCACATATAACCATC	This paper	N/A
gRNA targeting Mtf2 exon 15 Forward: CACCGCCTCTTCTTCTCCGCAAATG	This paper	N/A
gRNA targeting Mtf2 exon 15 Reverse: AAACCATTTGCGGAGAAGAAGAGGC	This paper	N/A
Recombinant DNA
Plasmid: pSpCas9(BB)-2A-GFP (PX458)	Zhang Laboratory	Addgene plasmid #48138
Plasmid: pCAG 2XFLAG-HA	Pasini laboratory	N/A
Software and Algorithms
Bowtie v1.2.2	Langmead et al., 2009	http://bowtie-bio.sourceforge.net/index.shtml
PICARD	N/A	http://broadinstitute.github.io/picard
MACS2 v2.1.1	Zhang et al., 2008	https://github.com/taoliu/MACS
ChIPpeakAnno v3.15	Zhu et al., 2010	Zhu et al., 2010
VennDiagram v1.6.20	Chen and Boutros, 2011	https://www.rdocumentation.org/packages/VennDiagram
ClusterProfiler	Yu and Cheng, 2019	http://bioconductor.org/packages/release/bioc/html/clusterProfiler.html
HOMER	Heinz et al., 2010	http://homer.ucsd.edu/
DeepTools 2.0	Ramírez et al., 2016	https://deeptools.readthedocs.io/en/latest/
STAR v2.7	N/A	N/A
DESeq2 v1.20	Love et al., 2014	N/A
TopHat v2.1.1	Trapnell et al., 2009	https://ccb.jhu.edu/software/tophat/
HTseq-count v0.8.0	Anders et al., 2015	http://www-huber.embl.de/HTSeq
MaxQuant software (version 1.5.2.8)	Cox and Mann, 2008	https://maxquant.org