REAGENT or RESOURCE | SOURCE | IDENTIFIER |
---|---|---|
Antibodies | ||
Rabbit polyclonal anti-Pcgf1 | Scelfo et al., 2019 | N/A |
Rabbit polyclonal anti-Pcgf2 | Scelfo et al., 2019 | N/A |
Rabbit polyclonal anti-Pcgf6 | Scelfo et al., 2019 | N/A |
Rabbit polyclonal anti-Ring1b | Chiacchiera et al., 2016a | N/A |
Mouse monoclonal anti-Vinculin | Merck (Sigma Aldrich) | Cat# V9131; RRID: AB_477629 |
Rabbit polyclonal anti-DEDAF (RYBP) | Merck (Sigma Aldrich) | Cat# AB3637; RRID: AB_2285466 |
Rabbit polyclonal anti-Cbx7 | Abcam | Cat# ab21873; RRID: AB_726005 |
Rabbit monoclonal anti-Suz12 (D39F6) | Cell Signaling Technology | Cat# 3737; RRID: AB_2196850 |
Rabbit monoclonal anti-tri-methyl-histone H3 (Lys27) (C36B11) | Cell Signaling Technology | Cat# 9733; RRID: AB_2616029 |
Rabbit monoclonal anti-ubiquityl histone H2A (Lys119) (D27C4) | Cell Signaling Technology | Cat# 8240; RRID: AB_10891618 |
Rabbit monoclonal anti-Bap1 (D7W70) | Cell Signaling Technology | Cat# 13271; RRID: AB_2798168 |
Mouse monoclonal anti-H3K27me1 | Active Motif | Cat# 61015; RRID: AB_2715573 |
Rabbit monoclonal anti-di-methyl-histone H3 (Lys27) (D18C8) | Cell Signaling Technology | Cat# 9728; RRID: AB_1281338 |
Mouse monoclonal anti-Eed | Bracken et al., 2003 | N/A |
Mouse monoclonal anti-Ezh2 | Pasini et al., 2004 | N/A |
Rabbit monoclonal anti-histone H3 | Abcam | Cat# ab1791; RRID: AB_302613 |
Rabbit polyclonal anti-histone H2A (acidic patch) | Merck (Sigma Aldrich) | Cat# 07-146; RRID: AB_310394 |
Rabbit polyclonal anti-Mtf2 | Proteintech | Cat# 16208-1-AP; RRID: AB_2147370 |
Rabbit monoclonal anti-Jarid2 (D6M9X) | Cell Signaling Technology | Cat# 13594; RRID: AB_2798269 |
Goat polyclonal anti-Lamin B (M-20) | Santa Cruz Biotechnology | Cat# sc-6217; RRID: AB_648158 |
Rabbit polyclonal anti-C17orf96 (EPOP) | Active Motif | Cat# 61753; RRID: AB_2793758 |
Rabbit monoclonal anti-AEBP2 (D7C6X) | Cell Signaling Technology | Cat# 14129; RRID: AB_2798398 |
Rabbit monoclonal anti-HA (12CA5) | Pasini laboratory | N/A |
Goat polyclonal anti-Suz12 (P-15) | Santa Cruz Biotechnology | Cat# sc-46264; RRID: AB_2196857 |
Mouse monoclonal anti-Actin (AC-40) | Merck (Sigma Aldrich) | Cat# A3853; RRID: AB_262137 |
Rabbit IgG Control Antibody | Merck (Sigma Aldrich) | Cat# I5006; RRID: AB_1163659 |
Anti-FLAG M2 affinity gel | Merck (Sigma Aldrich) | Cat# A2220; RRID: AB_10063035 |
Bacterial and Virus Strains | ||
One Shot™ TOP10 Chemically Competent E. coli | Thermo Fisher Scientific (Invitrogen) | Cat# C404010 |
One Shot™ Stbl3™ Chemically Competent E. coli | Thermo Fisher Scientific (Invitrogen) | Cat# C737303 |
One Shot™ BL21(DE3) Chemically Competent E. coli | Thermo Fisher Scientific (Invitrogen) | Cat# C600003 |
Chemicals, Peptides, and Recombinant Proteins | ||
Leukemia Inhibitory Factor | Pasini laboratory | N/A |
CHIR-99021 | Aurogen | Cat# S1263 |
PD-0325901 | Aurogen | Cat# S1036 |
Lipofectamine 2000 Transfection Reagent | Thermo Fisher Scientific (Invitrogen) | Cat# 11668027 |
IGEPAL CA-630 | Merck (Sigma Aldrich) | Cat# I8896 |
3X FLAG Peptide | Merck (Millipore) | Cat# F4799 |
Ethylene glycol-bis(succinic acid N-hydroxysuccinimide ester) | Merck (Sigma Aldrich) | Cat# E3257 |
Critical Commercial Assays | ||
Agilent High Sensitivity DNA kit | Agilent | Cat# 5067-4626 |
QIAquick PCR purification kit | Qiagen | Cat# 28104 |
Quick-RNA™ MiniPrep extraction kit | Zymo Research | Cat# R1055 |
Deposited Data | ||
Raw files | This paper | GEO: GSE134053 |
Mouse reference genome NCBI build 38, GRCm38 | Genome Reference Consortium | https://www.ncbi.nlm.nih.gov/grc/mouse |
Drosophila reference genome Release 6 plus ISO1 mitochondrial genome | The FlyBase Consortium/Berkeley Drosophila Genome Project/Celera Genomics | https://www.ncbi.nlm.nih.gov/assembly/GCF_000001215.4/ |
Western Blot | This paper | https://doi.org/10.17632/x6k27wtknb.2 |
Experimental Models: Cell Lines | ||
Mouse: Parental: ES cell line ROSA26:creERT2 RING1A-/-; RING1Bfl/fl | Endoh et al., 2008 | N/A Strain of origin 129P2/Ola |
Mouse: ES cell line E14 | Pasini laboratory | N/A Strain of origin 129P2/Ola |
Mouse: RING1B WT: ES cell line ROSA26:creERT2 RING1A-/-; RING1Bfl/fl; RING1B WT | This paper | N/A Strain of origin 129P2/Ola |
Mouse: RING1B 153S: ES cell line ROSA26:creERT2 RING1A-/-; RING1Bfl/fl; RING1B I53S | This paper | N/A Strain of origin 129P2/Ola |
Mouse: EED fl/fl clone#1: ES cell line ROSA26:creERT2 EED fl/fl | This paper | N/A Strain of origin 129P2/Ola |
Mouse: EED fl/fl clone#4: ES cell line ROSA26:creERT2 EED fl/fl | This paper | N/A Strain of origin 129P2/Ola |
Mouse: Parental MTF2 KO: ES cell line ROSA26:creERT2 RING1A-/-; RING1Bfl/fl; MTF2-/- | This paper | N/A Strain of origin 129P2/Ola |
Mouse: RING1B WT MTF2 KO: ES cell line ROSA26:creERT2 RING1A-/-; RING1Bfl/fl; RING1B WT; MTF2-/- | This paper | N/A Strain of origin 129P2/Ola |
Mouse: RING1B I53S MTF2 KO: ES cell line ROSA26:creERT2 RING1A-/-; RING1Bfl/fl; RING1B I53S; MTF2-/- | This paper | N/A Strain of origin 129P2/Ola |
Mouse: Ezh2 KO Ezh1 KO: ES cell line EZH2-/-;EZH1-/- | Lavarone et al., 2019 | N/A Strain of origin 129P2/Ola |
Drosophila S2 cell line | ATCC | ATCC CRL- 1963 |
Oligonucleotides | ||
gRNA targeting Mtf2 exon 4 Forward: CACCGATGGTTATATGTGATAAGTG | This paper | N/A |
gRNA targeting Mtf2 exon 4 Reverse: AAACCACTTATCACATATAACCATC | This paper | N/A |
gRNA targeting Mtf2 exon 15 Forward: CACCGCCTCTTCTTCTCCGCAAATG | This paper | N/A |
gRNA targeting Mtf2 exon 15 Reverse: AAACCATTTGCGGAGAAGAAGAGGC | This paper | N/A |
Recombinant DNA | ||
Plasmid: pSpCas9(BB)-2A-GFP (PX458) | Zhang Laboratory | Addgene plasmid #48138 |
Plasmid: pCAG 2XFLAG-HA | Pasini laboratory | N/A |
Software and Algorithms | ||
Bowtie v1.2.2 | Langmead et al., 2009 | http://bowtie-bio.sourceforge.net/index.shtml |
PICARD | N/A | http://broadinstitute.github.io/picard |
MACS2 v2.1.1 | Zhang et al., 2008 | https://github.com/taoliu/MACS |
ChIPpeakAnno v3.15 | Zhu et al., 2010 | Zhu et al., 2010 |
VennDiagram v1.6.20 | Chen and Boutros, 2011 | https://www.rdocumentation.org/packages/VennDiagram |
ClusterProfiler | Yu and Cheng, 2019 | http://bioconductor.org/packages/release/bioc/html/clusterProfiler.html |
HOMER | Heinz et al., 2010 | http://homer.ucsd.edu/ |
DeepTools 2.0 | Ramírez et al., 2016 | https://deeptools.readthedocs.io/en/latest/ |
STAR v2.7 | N/A | N/A |
DESeq2 v1.20 | Love et al., 2014 | N/A |
TopHat v2.1.1 | Trapnell et al., 2009 | https://ccb.jhu.edu/software/tophat/ |
HTseq-count v0.8.0 | Anders et al., 2015 | http://www-huber.embl.de/HTSeq |
MaxQuant software (version 1.5.2.8) | Cox and Mann, 2008 | https://maxquant.org |