Table 3.

Dysregulated miRNAs in PDAC and DECC patients who develop a VTE during follow-up, comparing the sample at inclusion and that right before the VTE event. miRNA sequences according to miRBase 22.1. Delta is defined as the difference of the average expression level of a miRNA between the samples at inclusion and the ones right before the VTE event. The negative values of delta represent down-regulation of miRNAs in the samples right before the VTE event.

miRNA	Sequence	p (t-Test)	Delta
hsa-miR-30e-3p	cuuucagucggauguuuacagc	0.015	−0.035
hsa-let-7i-5p	ugagguaguaguuugugcuguu	0.026	−0.062
hsa-let-7g-5p	ugagguaguaguuuguacaguu	0.03	−0.34
hsa-miR-144-3p	uacaguauagaugauguacu	0.03	−0.8
hsa-miR-199a-3p	acaguagucugcacauugguua	0.025	−0.11
hsa-miR-101-3p	uacaguacugugauaacugaa	0.029	−0.26
hsa-miR-15a-5p	uagcagcacauaaugguuugug	0.031	−0.07