Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
PCR templates and primers used to prepare transformation inserts
| Primer pair | Sequence (5′ to 3′) | Template |
|---|---|---|
| PyrG or ligD deletion cassettes | ||
| pRI | gcaattaatgtgagttagctcactc | pRIdP or pRIdLR |
| ggatatcggggaagaacagtatgtc | ||
| Enzyme production cassettes | ||
| pMD20c | cagtgagcgcaacgcaattaatgtgagttag | pPPO enzyme |
| gggatgtgctgcaaggcgattaagttg | ||
Templates are the plasmid constructs prepared in this study (Fig. 6)
