| Antibodies |
| Monoclonal ANTI-FLAG M2 antibody produced in mouse |
Sigma-Aldrich |
Cat# F3165, RRID:AB_259529 |
| Anti-Actin antibody produced in rabbit |
Sigma-Aldrich |
Cat# A2066, RRID:AB_476693 |
| Rabbit Anti-HA-Tag Monoclonal Antibody, Unconjugated, Clone C29F4 |
Cell Signaling Technology |
Cat# 3724, RRID:AB_1549585 |
| Anti-mouse IgG, HRP-linked Antibody |
Cell Signaling Technology |
Cat# 7076, RRID:AB_330924 |
| Peroxidase-AffiniPure Goat Anti-Rabbit IgG (H+L) antibody |
Jackson ImmunoResearch Labs |
Cat# 111-035-003, RRID:AB_2313567 |
| Anti-FLAG® M2 Magnetic Beads |
Sigma-Aldrich |
Cat#M8823 |
| Bacterial and Virus Strains |
|
Escherichia coli, cytR- |
Caenorhabditis Genetics Center (CGC) |
RRID:WB-STRAIN:WBStrain00041974 |
|
Escherichia coli, OP50 |
CGC |
N/A |
|
Escherichia coli, HT115(DE3) |
CGC |
N/A |
| RNAi feeding bacterial strain HT115(DE3) |
GE Dharmacon (ORF RNAi library) |
N/A |
| RNAi feeding bacterial strain HT115(DE3) |
Source BioScience (Ahringer) |
N/A |
| Chemicals, Peptides, and Recombinant Proteins |
| Uridine |
Sigma-Aldrich |
Cat#U3003 |
| Thymidine |
Sigma-Aldrich |
Cat#T9250 |
| Cytidine |
Sigma-Aldrich |
Cat#C4654 |
| Hydroxyurea |
Sigma-Aldrich |
Cat#H8627 |
| 5-Fluorouracil (5-FU) |
Sigma-Aldrich |
Cat#F6627 |
| 5-Fluoro-2′-deoxyuridine (FUDR) |
Sigma-Aldrich |
Cat#F0503 |
| Critical Commercial Assays |
| WST-8 Cell Proliferation Assay Kit |
Cayman Chemical |
Cat#10010199 |
| Cyclic AMP ELISA Kit |
Cayman Chemical |
Cat# 581001 |
| Brilliant III Ultra-Fast SYBR Green QPCR Master Mix |
Agilent Technologies |
Cat# 600882 |
| SuperSep Phos-tag, 12.5%, 17 well gels |
Wako Pure Chemical Corporation |
Cat#195-17991 |
| Halt Protease and Phosphatase Inhibitor Cocktail |
ThermoFisher |
Cat#78440 |
| Pierce Coomassie (Bradford) Protein Assay Kit |
ThermoFisher |
Cat#1856209 |
| Lipofectamine RNAiMAX Transfection Reagent |
ThermoFisher |
Cat#13778075 |
| Pierce ECL Plus Western Blotting Substrate |
ThermoFisher |
Cat#32132 |
| Experimental Models: Cell Lines |
| HeLa cells |
ATCC |
Cat# CCL-2, RRID:CVCL_0030 |
| Experimental Models: Organisms/Strains |
| C. elegans: N2 |
Caenorhabditis Genetics Center (CGC) |
N/A |
| C. elegans: Strain VC208: cdd-1(ok390) |
CGC |
WB Strain: VC208 |
| C. elegans: Strain CB4037: glp-1(e2141) |
CGC |
WB Strain: CB4037 |
| C. elegans: Strain CB4856, Hawaiian strain |
CGC |
WB Strain: CB4856 |
| C. elegans: Strain cdd-2(tm742) |
Mitani lab,National BioResource Project, Tokyo, Japan |
N/A |
| C. elegans: Strain hjIs67[atgl-1p::atgl-1::gfp] |
Zhang et al., 2010 |
N/A |
| C. elegans: Strain qyIs92[hda-1 > HDA-1::GFP] |
Matus et al., 2015 |
N/A |
| C. elegans: Strain MH5737 (kuIs114[Pendu-2:gfp:endu-2 3′UTR + unc-119]; unc-119)
|
This paper |
N/A |
| C. elegans: Strain MH5661 (kuIs112[Pendu-2(short):ha::endu-2:endu-2 3′UTR + unc-119]; unc-119)
|
This paper |
N/A |
| C. elegans: Strain cddko: cdd-1(ok390); cdd-2(tm742) |
Chi et al., 2016 |
N/A |
| C. elegans: Strain cddko; Ex[Pendu-2:endu-2+sur-5::dsRed]
|
This paper |
N/A |
| C. elegans: Strain cddko; Ex[Pges-1:endu-2]
|
This paper |
N/A |
| C. elegans: Strain cddko; Ex[Pendu-2:endu-2(H470A)+sur-5::dsRed]
|
This paper |
N/A |
| C. elegans: Strain endu-2(ku553) |
This paper |
N/A |
| C. elegans: Strain ctps-1(ku554) |
This paper |
N/A |
| C. elegans: Strain ctps-1(ku554, ku555) |
This paper |
N/A |
| C. elegans: Strain ctps-1(ku554); Ex[Pges-1:pka(dn)+sur-5::gfp]
|
This paper |
N/A |
| Oligonucleotides |
|
ku553 sgRNA: aaattatcctggataggcag |
This paper |
N/A |
|
ku553 repair template: gatggttctggaacttgcttggcaattgcctatccaggataatttatgacttgttcttg |
This paper |
N/A |
|
ku554 sgRNA: ctcgtctattacagagatgc |
This paper |
N/A |
|
ku554 repair template: ttatcaatttatctcgtctattacagagatggactacaaggacgacgacgacaagccaggcgaaaaacgcgtaaaatacattctggtg |
This paper |
N/A |
|
ku555 sgRNA: taagaagcgaaccgacagct |
This paper |
N/A |
|
ku555 repair template: atttgggatgttaagaagcgaaccgacgcctctgcggagcttatgcagatggctgatcag |
This paper |
N/A |
| EndoU siRNA |
Dharmacon |
SMARTpool: M-012187-00-0005 |
| Recombinant DNA |
| Plasmid: pPD95.77 |
pPD95.77 was a gift from Andrew Fire |
Addgene Plasmid #1495 |
| Pladmid: pDD162 |
Dickinson et al., 2013 |
Addgene Plasmid #47549 |
| Plasmid: pHW154: Punc-47(FL)::kin-2a(G310D) |
Wang and Sieburth, 2013 |
N/A |
| Plasmid: L4440-acy-4RNAi
|
This paper |
N/A |
| Software and Algorithms |
| OASIS2 |
Han et al., 2016 |
N/A |
| Fiji (ImageJ) |
http://fiji.sc |
Ver 1.50i; RRID:SCR_002285 |
| Prism 5 |
GraphPad |
N/A |
