Key resources table.
| Reagent type (species) |
Designation | Source or reference |
Identifiers | Additional Information |
|---|---|---|---|---|
| Recombinant DNA reagent | p89.6 | Collman et al. (1992) PMID: 1433527 | NIH AIDS Reagent Program 3552 | |
| Recombinant DNA reagent | p89.6 vpr-null | Mashiba et al. (2014); PMID 25464830 | ||
| Recombinant DNA reagent | p89.6 nef-null | Carter et al. (2010); PMID 20208541 | ||
| Recombinant DNA reagent | p89.6 vpr-nef-null | this paper | Produces HIV 89.6 vpr-nef-null double mutant | |
| Recombinant DNA reagent | p89.6 env N230D N339E | this paper | Produces HIV 89.6 env N230D N339E mutant | |
| Recombinant DNA reagent | p89.6 env N230D N339E vpr-null | this paper | Produces HIV 89.6 env N230D N339E vpr-null mutant | |
| Recombinant DNA reagent | p89.6 env N230D N339E vpr-nef-null | this paper | Produces HIV 89.6 env N230D N339E vpr-nef-null mutant | |
| Recombinant DNA reagent | pNL4-3 | Adachi et al. (1986); PMID 3016298 | NIH AIDS Reagent Program 114 | |
| Recombinant DNA reagent | pNL4-3 envYU2 | this paper | Produces HIV NL4-3 envYU2 chimera | |
| Recombinant DNA reagent | pNL4-3 envYU2vpr-null | this paper | Produces HIV NL4-3 envYU2vpr-null chimera | |
| Recombinant DNA reagent | pHCMV-G | ATCC | 75497 | Expresses VSV-G |
| Recombinant DNA reagent | pCMV-HIV-1 | Gasmi et al., 1999; PMID 9971760 | Expresses HIV structural proteins | |
| Recombinant DNA reagent | pNL4-3 ∆GPE-GFP | McNamara et al. (2012); PMID 22718820 | ||
| Recombinant DNA reagent | pNL4-3 ∆GPE-GFP vpr-null | this paper | Produces NL4-3 ∆GPE vpr-null | |
| Recombinant DNA reagent | pNL4-3 ∆GPE-GFP vpr-Q65R | this paper | Produces NL4-3 ∆GPE vpr-Q65R | |
| Recombinant DNA reagent | pNL4-3 ∆GPE-GFP nef-null | this paper | Produces NL4-3 ∆GPE nef-null | |
| Recombinant DNA reagent | pNL4-3 ∆GPE-GFP vpr-nef-null | this paper | Produces NL4-3 ∆GPE vpr-nef-null | |
| Recombinant DNA reagent | pYU2 | Li et al. (1991); PMID 1830110 | NIH AIDS Reagent Program 1350 | |
| Recombinant DNA reagent | pYU2 vpr-null | this paper | Produces YU-2 vpr-null | |
| Recombinant DNA reagent | pREJO.c/2864 | Ochsenbauer et al. (2012); PMID 22190722 | NIH AIDS Reagent Program 11746 | |
| Recombinant DNA reagent | pREJO.c/2864 vpr-null | this paper | Produces REJO vpr-null | |
| Recombinant DNA reagent | pSIV3+ | Pertel et al. (2011); PMID 21696578 | ||
| Recombinant DNA reagent | pSIV3+ vpr-null | this paper | Produces SIV3+ vpr-null | |
| Recombinant DNA reagent | pSPAX2 | Pertel et al. (2011); PMID 21696578 | ||
| Recombinant DNA reagent | pAPM-1221 | Pertel et al. (2011); PMID 21696578 | Silences luciferase mRNA | |
| Recombinant DNA reagent | pAPM-MRC1-C | this paper | Silences MR mRNA | |
| Recombinant DNA reagent | pMD2.G | Pertel et al. (2011); PMID 21696578 | Expresses VSV-G | |
| Recombinant DNA reagent | pYU2 env | Sullivan et al. (1995); PMID 7769703 | ||
| Recombinant DNA reagent | pCDNA3.hMR | Liu et al. (2004); PMID 15047828 | Expresses MR | |
| Recombinant DNA reagent | pPROA-3FLAG-UNG2-EYFP | Akbari et al. (2010); PMID 20466601 | ||
| Recombinant DNA reagent | pMSCV IRES-GFP | Van Parijs et al., 1999; PMID 10514006 | ||
| Recombinant DNA reagent | pMSCV 3xFLAG UNG2 IRES-GFP | this paper | Expresses 3x FLAG-tagged UNG2 | |
| Recombinant DNA reagent | pUC19 | Norrander et al. (1983); PMID 6323249 | ||
| Chemical compound, drug | Ficoll-Paque Plus | GE Healthcare | 17-1440-02 | |
| Chemical compound, drug | rhM-CSF | R and D Systems | 216-MC-025/CF | |
| Chemical compound, drug | rhGM-CSF | R&D Systems | 215 GM-050 | |
| Chemical compound, drug | IL-2 | R&D Systems | 202-IL-010 | |
| Chemical compound, drug | phytohaemagglutinin-L | Calbiohem | 431784 | |
| Chemical compound, drug | Enzyme-free cell dissociation buffer, HBSS-based | ThermoFisher | 13150016 | |
| Chemical compound, drug | Blue loading buffer | Cell Signaling Technology | 7722 | |
| Chemical compound, drug | AMD3100 | Hendrix et al., 2000; PMID 10817726 | NIH AIDS Reagent Program 8128 | |
| Chemical compound, drug | Maraviroc | Emmelkamp and Rockstroh, 2007; PMID 17933722 | NIH AIDS Reagent Program 11580 | |
| Chemical compound, drug | streptavidin-HRP | Fitzgerald | 65R-S104PHRP | |
| Chemical compound, drug | 3,3',5,5'-tetramethylbenzidine | Sigma | T8665-IL | |
| Chemical compound, drug | Gag p24 standard | ViroGen | 00177 V | |
| Chemical compound, drug | Protein G Column | GE Healthcare | 45-000-054 | |
| Commercial assay, kit | Q5 site-directed mutagenesis kit | New England Biolabs | E0554S | |
| Commercial assay, kit | EasySep Human CD14 Positive Selection Kit II | Stemcell Technologies | 17858 | |
| Commercial assay, kit | CD8 Dynabeads | ThermoFisher | 11147D | |
| Commercial assay, kit | RNeasy micro RNA isolation kit | Qiagen | 74004 | |
| Commercial assay, kit | qScript cDNA Supermix | Quantabio | 95048 | |
| Commercial assay, kit | TaqMan Gene Expression Master Mix | ThermoFisher | 4369016 | |
| Commercial assay, kit | EZ-link Micro Sulfo-NHS-Biotinylation kit | ThermoFisher | PI-21925 | |
| Sequence-based reagent | 896 dNef-F | this paper | PCR primer | CACCATTATCGTTTCAGACCCT |
| Sequence-based reagent | 896 dNef-R | this paper | PCR primer | TCTCGAGTTTAAACTTAT AGCAAAGCCCTTTCCA |
| Sequence-based reagent | NL43 vprQ65R-Forward | this paper | PCR primer | AGAATTCTGCGACAACTGCTG |
| Sequence-based reagent | NL43 vprQ65R-Reverse | this paper | PCR primer | TATTATGGCTTCCACTCC |
| Sequence-based reagent | 3xFLAG UNG2 F | this paper | PCR primer | CTAGCTCGAGACCATGGACT ACAAAGACCATGAC |
| Sequence-based reagent | 3xFLAG UNG2 R | this paper | PCR primer | GTTAACTCACAGCTCCTTC CAGTCAATGGGCTT |
| Sequence-based reagent | GeneExpression assay for ACTB | ThermoFisher | Hs99999903 | |
| Sequence-based reagent | GeneExpression assay for MRC1 | ThermoFisher | Hs00267207 | |
| Sequence-based reagent | GeneExpression assay for POL2A | ThermoFisher | Hs02786624 | |
| Sequence-based reagent | GeneExpression assay for GAPDH | ThermoFisher | Hs00172187 | |
| Sequence-based reagent | APM-MRC1-C Forward oligo | Sigma | DNA oligo | TCGAGAAGGTATATTGCT GTTGACAGTGAGCGAGTA ACTTGACTGATAATCAATT AGTGAAGCCACAGATGTA ATTGATTATCAGTCAAGTT ACTTGCCTACTGCCTCGG |
| Sequence-based reagent | APM-MRC1-C Reverse oligo | Sigma | DNA oligo | AATTCCGAGGCAGTAGGC AAGTAACTTGACTGATAA TCAATTACATCTGTGGCT TCACTAATTGATTATCAG TCAAGTTACTCGCTCACT GTCAACAGCAATATACCTTC |
| Biological sample (Homo sapiens) | Buffy coats/LeukoPaks | New York Blood Center | Buffy coats made from whole blood | |
| Biological sample (adenovirus) | Adeno-nef | Leonard et al. (2011); PMID 21543478 | ||
| Cell line (Homo sapiens) | HEK293T | ATCC | CRL-3216 | |
| Cell line (Mus musculus) | anti-gp41 hybridoma CHESSIE-8 | Abacioglu et al. (1994); PMID 8068416 | NIH AIDS Reagent Program 526 | Purified ab used for WB (2 µg/mL) |
| Cell line (Mus musculus) | anti-p24 hybridoma 183-H12-5C | NIH AIDS Reagent Program | 1513 | Purified ab used for ELISA (1 µg/mL) |
| Cell line (Mus musculus) | anti-p24 hybridoma 31-90-25 | ATCC (discontinued) | HB-9725 | Purified ab used for ELISA (0.5 µg/mL) |
| Antibody | anti-mannose receptor-PE (mouse monoclonal) | Becton Dickinson | clone 19.2 cat# 555954 | FC (1 µL per test) |
| Antibody | anti-Gag CA p24-PE (mouse monoclonal) | Beckman Coulter | clone KC57 cat# 6604667 | FC (0.25 µL per test) |
| Antibody | anti-Gag CA p24-FITC (mouse monoclonal) | Beckman Coulter | clone KC57 cat# 6604665 | FC (0.25 µL per test) |
| Antibody | anti-FLAG (mouse monoclonal) | Sigma | clone M2 cat# F3165 | FC (1 µL per test), WB (1:1000) |
| Antibody | anti-CD4-APC (mouse monoclonal) | ThermoFisher | clone OKT4 cat# 17-0048-42 | FC (1 µL per test) |
| Antibody | anti-CD3-PacBlue (mouse monoclonal) | BioLegend | clone OKT3 cat# 317313 | FC (1 µL per test) |
| Antibody | anti-CD14-APC (mouse monoclonal) | BioLegend | clone HCD14 cat# 325608 | FC (1 µL per test) |
| Antibody | anti-mannose receptor (rabbit polyclonal) | Abcam | ab64693 | WB (1:1000) |
| Antibody | anti-rabbit-AF647 (goat polyclonal) | ThermoFisher | A21244 | WB (1:4000) |
| Antibody | anti-GAPDH (mouse monoclonal) | Abnova | clone 3C2 cat# H00002597-M01 | WB (1:2000) |
| Antibody | anti-mouse IgG1-AF647 (goat polyclonal) | ThermoFisher | A21240 | FC (1 µL per test), WB (1:4000) |
| Antibody | HIV-Ig (human polyclonal) | Cummins et al. (1991); PMID 1995097 | NIH AIDS Reagent Program 3957 | WB (1:2000) |
| Antibody | anti-human-AF647 (goat polyclonal) | ThermoFisher | A21445 | WB (1:4000) |
| Antibody | anti-gp120 (sheep polyclonal) | Hatch et al., 1992; PMID 1374448 | NIH AIDS Reagent Program 288 | WB (1:1000) |
| Antibody | anti-sheep-HRP (rabbit polyclonal) | Dako | P0163 | WB (1:20,000) |
| Antibody | anti-gp41 (human monoclonal) | Zwick et al. (2001); PMID 11602729 | NIH AIDS Reagent Program 11557 | WB (1:1000) |
| Antibody | anti-human (goat polyclonal) | ThermoFisher | 62–8420 | WB (1:10,000) |
| Antibody | anti-Nef (rabbit polyclonal) | Shugars et al. (1993); PMID 8043040 | NIH AIDS Reagent Program 2949 | WB (1:1000) |
| Antibody | anti-Vpr (rabbit polyclonal) | Dr. Jeffrey Kopp | NIH AIDS Reagent Program 11836 | WB (1:1000) |
| Antibody | anti-rabbit (goat polyclonal) | ThermoFisher | 65–6120 | WB (1:10,000) |
| Antibody | anti-GFP (chicken polyclonal) | Abcam | ab13970 | WB (1:1000) |
| Antibody | anti-chicken-HRP (goat polyclonal) | ThermoFisher | A16054 | WB (1:10,000) |
| Antibody | anti-STING (rabbit monoclonal) | Cell Signaling Technology | clone D2P2F cat# 13647 | WB (1:500) |
| Antibody | anti-GBP5 (goat polyclonal) | Dr. Frank Kicrhhoff | sc-160353 | WB (1:500) |
| Antibody | anti-IFITM3 (rabbit polyclonal) | Proteintech | 11714–1-AP | WB (1:1000) |
| Antibody | anti-Env 2G12 (human monoclonal) | Buchacher et al. (1994); PMID 7520721 | NIH AIDS Reagent Program 1476 | neutralization (1 µg/mL) |
| Software, algorithm | FlowJo 10 | BD | 10.6.1 | |
| Software, algorithm | ABI Sequence Detection Software | ThermoFisher | 1.4 | |
| Software, algorithm | ImageQuant TL | GE | 8.2.0 | |
| Software, algorithm | Photoshop CC | Adobe | 20.0.6 | |
| Software, algorithm | shRNA retriever | http://katahdin.mssm.edu/siRNA/RNAi.cgi?type=shRNA |