Skip to main content
. 2020 Mar 2;86(6):e02425-19. doi: 10.1128/AEM.02425-19

TABLE 3.

Primers used in this study

Primer DNA sequence (5′ to 3′)a Description
aceAB-F TAAGAAGGAGATATACATATGTCGTGCCGATGCGCACGC Forward primer to amplify aceAB with an NdeI site
aceAB-R GTGGTGGTGGTGGTGCTCGAGGCCGATGATCTCGTCCATGG Reverse primer to amplify aceAB with an XhoI site
RT-16SF ATCGTTTAGGGCGTGGACT Forward primer for quantitative real-time PCR to amplify a 128-bp fragment of 16S rRNA
RT-16SR GAAATGCGTAGATATGTGGAGG Reverse primer for quantitative real-time PCR to amplify a 128-bp fragment of 16S rRNA
RT-aceAF CCGACTGGCTGGACTACTTCTA Forward primer for quantitative real-time PCR to amplify a 105-bp fragment of aceA
RT-aceAR CCTTGCTCTGATCGCTGTTT Reverse primer for quantitative real-time PCR to amplify a 105-bp fragment of aceA
RT-aceBF ACGCAGGTGATGCAGAATG Forward primer for quantitative real-time PCR to amplify a 120-bp fragment of aceB
RT-aceBR GTCGTAGGTGGATAGACCGTAG Reverse primer for quantitative real-time PCR to amplify a 120-bp fragment of aceB
aceA-F TAAGAAGGAGATATACATATGATCACTTCTCCATAC Forward primer to amplify aceA with an NdeI site
aceA-R GTGGTGGTGGTGGTGCTCGAGGACGGCCACGCCGATCTTC Reverse primer to amplify aceA with an Xhol site
aceB-F TAAGAAGGAGATATACATATGAACTATATTCCGGTCAAGG Forward primer to amplify aceB with an NdeI site
aceB-R GTGGTGGTGGTGGTGCTCGAGGCCGATGATCTCGTCCATGG Reverse primer to amplify aceB with an Xhol site
aceB-DF TATGACCATGATTACGAATTCAGGGCGCTCAGCCGAGGC Forward primer to amplify aceB for gene deletion
aceB-DR CAGGTCGACTCTAGAGGATCCAGAGCAGATCTTCCCCCTCG Reverse primer to amplify aceB for gene deletion
aceB-CF GATAAGCTTGATATCGAATTCGGCCTCTCCCGGATTCTCT Forward primer to amplify aceB with an EcoRI site for gene complementation
aceB-CR CGCTCTAGAACTAGTGGATCCTCAGCCGATGATCTCGTCCA Reverse primer to amplify aceB with a BamHI site for gene complementation
a

Underlined sequences are restriction enzyme cutting sites.