Skip to main content
. Author manuscript; available in PMC: 2020 Apr 1.
Published in final edited form as: Cell Metab. 2019 Aug 29;30(4):784–799.e5. doi: 10.1016/j.cmet.2019.08.003

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
Anti-TFAM antibody Sigma Cat#SAB1401383
Anti-COX IV antibody Abcam Cat#Ab16056
Total OXPHOS Rodent WB Antibody Cocktail Abcam Cat#ab110413
Anti-Collagen I antibody Abcam Cat# ab34710
Anti-Fibronectin antibody Abcam Cat#Ab2413
IκBα (L35A5) Mouse mAb Cell Signaling Cat#4814
Phospho-IκBα (Ser32) (14D4) Rabbit mAb Cell Signaling Cat#2859
Anti-NF-kB p65 antibody Abcam Cat# ab16502
Anti-CTCF Antibody Millipore Sigma Cat# 07-729
Monoclonal Anti-β-Actin antibody Sigma Cat#A5441
Antibodies for Immunohistochemistry (IHC)
TFAM Antibody Proteintech Cat#22586-1-AP
Anti-COX IV antibody Abcam Cat#Ab16056
Anti-NF-kB p65 antibody Abcam Cat# ab16502
Ki-67 (D3B5) Rabbit mAb Cell Signaling Cat# #12202
Antibodies for Immunofluorescence (IF)
Anti-NF-kB p65 antibody Abcam Cat# ab16502
Anti-DNA Antibody Millipore Sigma Cat# CBL186
Secondary Antibodies
Anti-rabbit IgG, HRP-linked Antibody Cell Signaling Cat#7074
Anti-mouse IgG, HRP-linked Antibody Cell Signaling Cat#7076
Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody Invitrogen Cat#A-31572
Chicken anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody Invitrogen Cat#A-21200
Bacterial and Virus Strains
Ad5CMVCre University of Iowa Gene Transfer Vector Core N/A
Ad5CMV-eGFP University of Iowa Gene Transfer Vector Core N/A
Biological Samples
Human kidney samples This paper N/A
Chemicals, Peptides, and Recombinant Proteins
C-176 Vitas-M laboratory Cat#STK016322
Collagenase IV Life Technologies Cat#17104019
Lipofectamine 3000 ThermoFisher Cat#11668027
Trypan blue solution Sigma Cat#T8154
Protease inhibitor cocktail Roche Cat#11836153001
RIPA buffer Cell signaling Cat#9806
Folic acid Fisher Scientific Cat#AC216630500
Critical Commercial Assays
Nuclei pure prep isolation kit Sigma Cat#NUC-201
BCA Protein Assay Kit Thermo Scientific Cat#23225
cDNA Reverse Transcription Kit Applied Biosystems Cat#4368813
Rneasy Mini Kit Qiagen Cat#74106
RNAscope® 2.5 HD Duplex Detection Kit Acdbio Cat#322430
DNeasy Blood & Tissue Kits Qiagen Cat#69506
Cytoselect 96-well Cell migration assay KIT Cell Biolabs Cat#CBA-105
ATP Colorimetric/Fluorometric Assay Kit BioVision Cat#K354
Deposited Data
Human Kidneys: RNA-seq GEO GSE115098
Tfam−/− mice Kidneys: RNA-seq GEO GSE134950
Experimental Models: Cell Lines
Raw264.7 cell line ATCC Cat#TIB-71™
Experimental Models: Organisms/Strains
B6.Cg-Tg(Cdh16-cre)91Igr/J Jackson Laboratory Cat#012237
B6.Cg-Tfam<tm1.1Ncdl>/J Jackson Laboratory Cat#026123
B6(Cg)-Tmem173<tm1.2Camb>/J Jackson Laboratory Cat#025805
Oligonucleotides
Primers for qPCR, see Table S3 This paper N/A
siRNA targeting sequence: Tmem173 (Duplex 1): GAAUCGGGUUUAUUCCAACAGCGTC IDT N/A
siRNA targeting sequence: Tmem173 (Duplex 2): UUCUUAGCCCAAAUAAGGUUGUCGCAG IDT N/A
Software and Algorithms
ImageJ NIH https://imagej.nih.gov/ij
Prism 5 Graphpad Software https://www.graphpad.com/scientific-software/prism
STAR v2.4.1d Cold Spring Harbor Laboratory http://code.google.com/p/rna-star/
David v6.8 Laboratory of Human Retrovirology and Immunoinformatics (LHRI) https://david.ncifcrf.gov/
GSEA Desktop v3.0 Broad Institute, Inc.,Massachusetts Institute of Technology http://software.broadinstitute.org/gsea/index.jsp