KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Anti-TFAM antibody | Sigma | Cat#SAB1401383 |
| Anti-COX IV antibody | Abcam | Cat#Ab16056 |
| Total OXPHOS Rodent WB Antibody Cocktail | Abcam | Cat#ab110413 |
| Anti-Collagen I antibody | Abcam | Cat# ab34710 |
| Anti-Fibronectin antibody | Abcam | Cat#Ab2413 |
| IκBα (L35A5) Mouse mAb | Cell Signaling | Cat#4814 |
| Phospho-IκBα (Ser32) (14D4) Rabbit mAb | Cell Signaling | Cat#2859 |
| Anti-NF-kB p65 antibody | Abcam | Cat# ab16502 |
| Anti-CTCF Antibody | Millipore Sigma | Cat# 07-729 |
| Monoclonal Anti-β-Actin antibody | Sigma | Cat#A5441 |
| Antibodies for Immunohistochemistry (IHC) | ||
| TFAM Antibody | Proteintech | Cat#22586-1-AP |
| Anti-COX IV antibody | Abcam | Cat#Ab16056 |
| Anti-NF-kB p65 antibody | Abcam | Cat# ab16502 |
| Ki-67 (D3B5) Rabbit mAb | Cell Signaling | Cat# #12202 |
| Antibodies for Immunofluorescence (IF) | ||
| Anti-NF-kB p65 antibody | Abcam | Cat# ab16502 |
| Anti-DNA Antibody | Millipore Sigma | Cat# CBL186 |
| Secondary Antibodies | ||
| Anti-rabbit IgG, HRP-linked Antibody | Cell Signaling | Cat#7074 |
| Anti-mouse IgG, HRP-linked Antibody | Cell Signaling | Cat#7076 |
| Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody | Invitrogen | Cat#A-31572 |
| Chicken anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody | Invitrogen | Cat#A-21200 |
| Bacterial and Virus Strains | ||
| Ad5CMVCre | University of Iowa Gene Transfer Vector Core | N/A |
| Ad5CMV-eGFP | University of Iowa Gene Transfer Vector Core | N/A |
| Biological Samples | ||
| Human kidney samples | This paper | N/A |
| Chemicals, Peptides, and Recombinant Proteins | ||
| C-176 | Vitas-M laboratory | Cat#STK016322 |
| Collagenase IV | Life Technologies | Cat#17104019 |
| Lipofectamine 3000 | ThermoFisher | Cat#11668027 |
| Trypan blue solution | Sigma | Cat#T8154 |
| Protease inhibitor cocktail | Roche | Cat#11836153001 |
| RIPA buffer | Cell signaling | Cat#9806 |
| Folic acid | Fisher Scientific | Cat#AC216630500 |
| Critical Commercial Assays | ||
| Nuclei pure prep isolation kit | Sigma | Cat#NUC-201 |
| BCA Protein Assay Kit | Thermo Scientific | Cat#23225 |
| cDNA Reverse Transcription Kit | Applied Biosystems | Cat#4368813 |
| Rneasy Mini Kit | Qiagen | Cat#74106 |
| RNAscope® 2.5 HD Duplex Detection Kit | Acdbio | Cat#322430 |
| DNeasy Blood & Tissue Kits | Qiagen | Cat#69506 |
| Cytoselect 96-well Cell migration assay KIT | Cell Biolabs | Cat#CBA-105 |
| ATP Colorimetric/Fluorometric Assay Kit | BioVision | Cat#K354 |
| Deposited Data | ||
| Human Kidneys: RNA-seq | GEO | GSE115098 |
| Tfam−/− mice Kidneys: RNA-seq | GEO | GSE134950 |
| Experimental Models: Cell Lines | ||
| Raw264.7 cell line | ATCC | Cat#TIB-71™ |
| Experimental Models: Organisms/Strains | ||
| B6.Cg-Tg(Cdh16-cre)91Igr/J | Jackson Laboratory | Cat#012237 |
| B6.Cg-Tfam<tm1.1Ncdl>/J | Jackson Laboratory | Cat#026123 |
| B6(Cg)-Tmem173<tm1.2Camb>/J | Jackson Laboratory | Cat#025805 |
| Oligonucleotides | ||
| Primers for qPCR, see Table S3 | This paper | N/A |
| siRNA targeting sequence: Tmem173 (Duplex 1): GAAUCGGGUUUAUUCCAACAGCGTC | IDT | N/A |
| siRNA targeting sequence: Tmem173 (Duplex 2): UUCUUAGCCCAAAUAAGGUUGUCGCAG | IDT | N/A |
| Software and Algorithms | ||
| ImageJ | NIH | https://imagej.nih.gov/ij |
| Prism 5 | Graphpad Software | https://www.graphpad.com/scientific-software/prism |
| STAR v2.4.1d | Cold Spring Harbor Laboratory | http://code.google.com/p/rna-star/ |
| David v6.8 | Laboratory of Human Retrovirology and Immunoinformatics (LHRI) | https://david.ncifcrf.gov/ |
| GSEA Desktop v3.0 | Broad Institute, Inc.,Massachusetts Institute of Technology | http://software.broadinstitute.org/gsea/index.jsp |