Table 1.

Forward and reverse primers used for the semi-nested PCR amplification of COI sequences.

Primers	Position	Sequence	GenBank accession no.	References
F1 COI primer	11–30	TGTACATACTTACGGCAGGT	KT901022.1	Rubiola et al., 2019
R1 COI primer	895–913	CCGTAGGTATGGCGATCAT	KT901022.1	Rubiola et al., 2019
R2 COI primer	400–419	AGGCCAAGAATTATCCAGTC	KT901022.1	This study