Table 2.
List of assays targeting genes of potential prey items of Lutjanus erythropterus and L. malabaricus, and host-specific blocking primer (LEBP, L. erythropterus blocking primer; LMBP, L. malabaricus blocking primer).
| Assay name | Assay sequence (5′-3′) | Target taxa | Target gene | T (°C) | Product size (bp) | Minimum length (bp) | Reference |
|---|---|---|---|---|---|---|---|
| 18 SUni (F) | GCCAGTAGTCATATGCTTGTCT | Universal | 18S | 52 | 350–420 | 200 | 66 |
| 18SUni (R) | GCCTGCTGCCTTCCTT | 66 | |||||
| SCeph (F) | GCTRGAATGAATGGTTTGAC | Cephalopods | 16S | 50 | 90–110 | 50 | 67 |
| SCeph (R) | TCAWTAGGGTCTTCTCGTCC | 67 | |||||
| SCrust (F) | GGGACGATAAGACCCTATA | Crustaceans | 16S | 51 | 140–190 | 100 | 47 |
| SCrust (R) | ATTACGCTGTTATCCCTAAAG | 47 | |||||
| Fish16S (F) | GACCCTATGGAGCTTTAGAC | Teleosts | 16S | 58 | 200 | 100 | 47 |
| Fish16S (R) | CGCTGTTATCCCTADRGTAACT | 26 | |||||
| LMBP | AGCTTTAGACACCAAGGCAGACCAT/C3/ | L. malabaricus | 16S | 58 | N/A | N/A | This study |
| LEBP | AGCTTTAGACACCAAGGCAGAACAT/C3/ | L. erythropterus | This study |
The first 10 base pairs of the blocking primers overlap with the 3′ end of the forward Fish16S assay (bold and italic font), followed by 15 base pairs of the host specific sequences. The C3 spacer at the 3′ end is a modified DNA oligonucleotide, which inhibits annealing. Minimum length of each assay is the threshold length used for quality filtering of sequences. T, annealing temperature; F, forward primer; R, reverse primer.