Table 1. Primers used for real-time polymerase chain reaction.
| Name | Symbol | Species | Forward (5′ to 3′) | Reverse (5′ to 3′) | Size (bp) |
|---|---|---|---|---|---|
| AIF1 | Aif1 | mouse | atcaacaagcaattcctcgatga | cagcattcgcttcaaggacata | 144 |
| Arg1 | Arg1 | mouse | ctccaagccaaagtccttagag | aggagctgtcattagggacatc | 185 |
| CCL2 | Ccl2 | mouse | ttaaaaacctggatcggaaccaa | gcattagcttcagatttacgggt | 121 |
| CCL3 | Ccl3 | mouse | ttctctgtaccatgacactctgc | cgtggaatcttccggctgtag | 100 |
| CCL4 | Ccl4 | mouse | ttcctgctgtttctcttacacct | ctgtctgcctcttttggtcag | 121 |
| CCL5 | Ccl5 | mouse | gctccaatcttgcagtcgtg | gagcagctgagatgcccatt | 242 |
| CCL7 | Ccl7 | mouse | gctgctttcagcatccaagtg | ccagggacaccgactactg | 135 |
| CCR1 | Ccr1 | mouse | tggtgggcaatgtcctagtg | aagtaacagttcgggccctc | 300 |
| CCR2 | Ccr2 | mouse | atccacggcatactatcaacatc | caaggctcaccatcatcgtag | 104 |
| CCR3 | Ccr3 | mouse | accccgtacaacctggttct | ccaacaaaggcgtagattactgg | 158 |
| CCR5 | Ccr5 | mouse | ttttcaagggtcagttccgac | ggaagaccatcatgttacccac | 158 |
| CRMP2 | Dpysl2 | mouse | tcaaaggtggcaagattgtgaa | ggaatcaccattctggagtgg | 145 |
| CXCL1 | Cxcl1 | mouse | ctgggattcacctcaagaacatc | cagggtcaaggcaagcctc | 117 |
| CXCL2 | Cxcl2 | mouse | tccagagcttgagtgtgacg | tggttcttccgttgagggac | 201 |
| CXCR2 | Cxcr2 | mouse | gggtggggagttcgtgtaga | aggtgctaggatttgagcct | 200 |
| ELANE | Elane | mouse | caggaacttcgtcatgtcagc | agcagttgtgatgggtcaaag | 162 |
| ENO2 | Eno2 | mouse | tgagaataaatccttggagctggt | ggtcatcgcccactatctgg | 302 |
| GAP43 | Gap43 | mouse | tctgctactaccgatgcagc | tggaggacggggagttatcag | 181 |
| GAPDH | Gapdh | mouse | gctacactgaggaccaggttgt | ctcctgttattatgggggtctg | 306 |
| GAPDH | Gapdh | human | ggagcgagatccctccaaaat | ggctgttgtcatacttctcatgg | 197 |
| GAPDH* | Gapdh | mouse | aggtcggtgtgaacggatttg | tgtagaccatgtagttgaggtca | 123 |
| IL-1β | Il1b | mouse | gcaactgttcctgaactcaact | atcttttggggtccgtcaact | 89 |
| IL-4 | Il4 | mouse | tctcgaatgtaccaggagccatatc | agcaccttggaagccctacaga | 183 |
| MCPIP | Zc3h12a | mouse | acgaagcctgtccaagaatcc | taggggcctctttagccaca | 115 |
| MPO | Mpo | mouse | agggccgctgattatctacat | ctcacgtcctgataggcaca | 152 |
| Ym-1 | Chil3 | mouse | ggtggacacagaatggttcttc | ccaggagcgttagtgacagc | 128 |
AIF: allograft inflammatory factor, Arg: arginase, CCL: chemokine (C-C motif) ligand, CCR: chemokine (C-C motif) receptor, Chil: chitinase-like, CRMP: collapsin response mediator protein, CXCL: chemokine (C-X-C motif) ligand, CXCR: chemokine (C-X-C motif) receptor, ELANE: neutrophil elastase, Eno: neuron-specific enolase, GAP: growth associated protein, GAPDH: glyceraldehyde-3-phosphate dehydrogenase, GFAP: glial fibrillary acidic protein, IL: interleukin, MCPIP: monocyte chemotactic protein-1 induced protein, MPO: myeloperoxidase, * = not species specific.