Key resources table.
| Reagent type (species) or resource |
Designation | Source/reference | Identifiers | Additional Information |
|---|---|---|---|---|
| Commercial assay or kit | Click-iT EdU Imaging Kit | Invitrogen | Invitrogen: C10338 | |
| Commercial assay or kit | PureLink RNA Mini Kit | Invitrogen | Invitrogen: 12183018A | |
| Commercial assay or kit | iScript cDNA Synthesis Kit | Biorad | Biorad: 170–8891 | |
| Commercial assay or kit | ALT Activity Assay | Sigma | Sigma: MAK052 | |
| Commercial assay or kit | AST Activity Assay | Sigma | Sigma: MAK055 | |
| Commercial assay or kit | ABC reagent | Vector Laboratories | Vector: PK-6100 | |
| Commercial assay or kit | DAB solution | Vector Laboratories | Vector: SK-4105 | |
| Commercial assay or kit | Pierce ECL Plus Western blotting Substrate | Pierce | Pierce: 32132 | |
| Commercial assay or kit | RNAscope 2.5 HD Duplex manual assay | Advanced cell diagnostics | Cat. #: 322436 | |
| Commercial assay or kit | DynabeadsTM FlowCompTM MouseCD4 kit | Invitrogen | Cat. #: 11461D | |
| Probe | RNAscope Probe Mm-Wnt2 | Advanced cell diagnostics | Cat #: 313601 | NM_023653.5, region 857–2086 |
| Probe | RNAscope Probe Mm-Rspo3-O2 | Advanced cell diagnostics | Cat. #: 483781 | NM_028351.3, region 717–2099 |
| Probe | RNAscope Probe Mm-Wnt9b | Advanced cell diagnostics | Cat.#: 405091 | NM_011719.4, region 706–1637 |
| Probe | RNAscope Probe Mm-Lyve1-C2 | Advanced cell diagnostics | Cat. #: 42451-C2 | NM_053247.4, region 2–952 |
| Probe | RNAscope Probe Positive Control Probe | Advanced cell diagnostics | Cat. #: 320761 | Mm-Polr2a, NM_001291068.1, region 3212–4088 |
| Probe | RNAscope 2-Plex Negative Control | Advanced cell diagnostics | Cat. #: 320751 | DapB, CP015375.1, region 2252107–2252555 |
| Antibody | anti-mouse GFP (chicken polyclonal) | Abcam | Cat. #: ab13970; RRID:AB_300798 | IF, IHC (1:1000) |
| Antibody | anti-mouse GS (rabbit polyclonal) | Abcam | Cat. #: ab49873; RRID:AB_880241 | IF, IHC (1:5000) |
| Antibody | anti mouse Cyp2e1 (rabbot polyclonal) | Abcam | Cat. #: ab28146; RRID:2089985 | IF, IHC (1:500) |
| Antibody | anti-mouse E-cadherin (rat monoclonal) | Novex | Cat. #: 13–1900; RRID:AB_2533005 | IF (1:5000) |
| Antibody | anti-mouse HNF-4α (goat polyclonal | Santa Cruz Biotechnology | Cat. #: sc-6556; RRID:AB_2117025 | IF (1:50) |
| Antibody | anti-mouse Prox1 (rabbit polyclonal) | Proteintech | Cat. #: 11067–2-AP; RRID:AB_2268804 | IF (1:1000) |
| Antibody | anti-mouse Tbx3 (rabbit polyclonal) | Abcam | Cat. #: ab99302; RRID:AB_10861059 | IF (1:100) |
| Antibody | anti-mouse APC (rabbit polyclonal) | Abcam | Cat. #: ab52223; RRID:AB_867687 | IF (1:50) |
| Antibody | anti-mouse F4/80 (rat monoclonal) | Abcam | Cat. #: ab6640; RRID:AB_1140040 | IF (1:1000) |
| Antibody | anti-mouse PECAM-1 (rat monoclonal) | BD Pharmingen | Cat. #: 550274; RRID:AB_393571 |
IF (1:100) MI (2 µg/25 µL) |
| Antibody | anti-mouse Lyve1 (goat polyclonal) | R and D Systems | Cat. #: BAF2125; RRID:AB_2138529 | IF (1:250) |
| Antibody | anti-mouse Claudin-2 (rabbit polyclonal) | Invitrogen | Cat. #: 51–6100; RRID:AB_2533911 | IHC (1:250) |
| Antibody | anti-mouse CD86 (rat monoclonal) | SouthernBiotech | Cat. #: 1735–01; RRID:AB_2795211 | IF (1:100) |
| Antibody | anti-mouse PCK1 (rabbit polyclonal) | Abcam | Cat. #: ab28455; RRID:AB_777191 |
IHC (1:100) |
| Antibody | anti-mouse Beta-gal (chicken polyclonal) | Abcam | Cat. #: ab9361; RRID:AB_307210 | IF (1:2000) |
| Antibody | anti-mouse Lyve1 (rat monoclonal) | R and D systems | Cat. #: MAB215, RRID:AB_2138528 | MI (2 µg/25 µL) |
| Antibody | anti-mouse CD117 (rat monoclonal) | R and D Systems | Cat. #: MAB1356; RRID:AB_2131131 | IF (1:50) MI (2 µg/25 µL) |
| Antibody | Cy3 Anti-Rabbit IgG (H+L) (donkey polyclonal) | Jackson ImmunoResearch | Cat. #: 705-165-152; RRID:AB_2307443 | IF (1:250) |
| Antibody | Cy3 Anti-Goat IgG (H+L) (donkey polyclonal) | Jackson ImmunoResearch | Cat. #: 705-165-147; RRID:AB_2307351 | IF (1:250) |
| Antibody | Cy3 Anti-Rat IgG (H+L) (donkey polyclonal) | Jackson ImmunoResearch | Cat. #: 712-165-153; RRID:AB_2340667 | IF (1:250) |
| Antibody | Alexa Fluor 488 Anti-Chicken IgY (IgG) (H+L) (donkey polyclonal) | Jackson ImmunoResearch | Cat. #: 703-545-155; RRID:AB_2340375 | IF (1:250) |
| Antibody | Alexa Fluor 488 Anti-Rat IgG (H+L) (donkey polyclonal) | Jackson ImmunoResearch | Cat. #: 712-545-153; RRID:AB_2340684 | IF (1:250) |
| Antibody | Alexa Fluor 488 Anti-Goat IgG (H+L) (donkey polyclonal) | Jackson ImmunoResearch | Cat. #: 705-545-147; RRID:AB_2336933 | IF (1:250) |
| Antibody | Biotin-SP (long spacer) Anti-Rabbit IgG (H+L) (donkey polyclonal) | Jackson ImmunoResearch | Cat. #: 711-065-152; RRID:AB_2340593 | IHC (1:250) |
| Sequencebased reagent | Glul_F | This paper | PCR primers | TGAACAAAGGCATCAAGCAAATG |
| Sequence-based reagent | Glul_R | This paper | PCR primers | CAGTCCAGGGTACGGGTCTT |
| Sequence- based reagent | Cyp2e1_F | This paper | PCR primers | CGTTGCCTTGCTTGTCTGGA |
| Sequence-based reagent | Cyp2e1_R | This paper | PCR primers | AAGAAAGGAATTGGGAAAGGTCC |
| Sequence- based reagent | Axin2_F | This paper | PCR primers | TGACTCTCCTTCCAGATCCCA |
| Sequence- based reagent | Axin2_R | This paper | PCR primers | TGCCCACACTAGGCTGACA |
| Sequence-based reagent | Cldn2_F | This paper | PCR primers | CAACTGGTGGGCTACATCCTA |
| Sequence- based reagent | Cldn2_R | This paper | PCR primers | CCCTTGGAAAAGCCAACCG |
| Sequence-based reagent | Tbx3_F | This paper | PCR primers | AGATCCGGTTATCCCTGGGAC |
| Sequence based reagent | Tbx3_R | This paper | PCR primers | CAGCAGCCCCCACTAACTG |
| Sequence-based reagent | Cdh1_F | This paper | PCR primers | CCAAGCACGTATCAGGGTCA |
| Sequence- based reagent | Cdh1_R | This paper | PCR primers | ACTGCTGGTCAGGATCGTTG |
| Sequence-based reagent | Prox1_F | This paper | PCR primers | AAGCGCAATGCAGGAAGGGCT |
| Sequence- based reagent | Prox1_R | This paper | PCR primers | ACCACTTGATGAGCTGCGAGG |
| Sequence- based reagent | Actb_F | This paper | PCR primers | AGATCAAGATCATTGCTCCTCCT |
| Sequence-based reagent | Actb_R | This paper | PCR primers | ACGCAGCTCAGTAACAGTCC |
| Sequence- based reagent | Apc_F | This paper | PCR primers | CTTGTGGCCCAGTTAAAATCTGA |
| Sequence- based reagent | Apc_R | This paper | PCR primers | CGCTTTTGAGGGTTGATTCCT |
| Sequence- based reagent | Wnt2_F | This paper | PCR primers | TCCGAAGTAGTCGGGAATCG |
| Sequence- based reagent | Wnt2_R | This paper | PCR primers | GCCCTGGTGATGGCAAATAC |
| Sequence- based reagent | Wnt9b_F | This paper | PCR primers | GGGCATCAAGGCTGTGAAGA |
| Sequence- based reagent | Wnt9b_R | This paper | PCR primers | AACAGCACAGGAGCCTGACA |
| Sequence- based reagent | Rspo3_F | This paper | PCR primers | ACACCTTGGAAAGTGCCTTGA |
| Sequence- based reagent | Rspo3_R | This paper | PCR primers | GCCTCACAGTGTACAATACTGACACA |
| Sequence- based reagent | Pecam1_F | This paper | PCR primers | AGCCTAGTGTGGAAGCCAAC |
| Sequence- based reagent | Pecam1_R | This paper | PCR primers | GGAGCCTTCCGTTCTTAGGG |
| Sequence- based reagent | Kit_F | This paper | PCR primers | CAGGAGCAGAGCAAAGGTGT |
| Sequence-based reagent | Kit_R | This paper | PCR primers | GGGCCTGGATTTGCTCTTTG |
| Sequence-based reagent | Lyve1_F | This paper | PCR primers | GCCAACGCGGCCTGTAAGAT |
| Sequence- based reagent | Lyve1_R | This paper | PCR primers | CCCAGGTGTCGGATGAGTTG |
| Sequence- based reagent | Dll4_F | This paper | PCR primers | TGTGATTGCCACAGAGGTATAAGG |
| Sequence- based reagent | Dll4_R | This paper | PCR primers | GCAATGTAAACAATGCAGAAGGAA |
| Cell line (Mus musculus) | Mus musculus AML12 Cell line | ATCC | Cat. #: CRL-2254; RRID:CVCL_0140 | |
| Cell culture media | DMEM F12 | Gibco | Cat. #: 11320–033 | |
| Chemical compound, drug | Dexamethasone | Sigma-Aldrich | Cat. #: D4902 | (40 ng/ml) |
| Chemical compound, drug | 10 mg/ml insulin,5.5 mg/ml transferrin,5 ng/ml selenium | Gibco | Cat. #: 41400045 | (1X) |
| Chemical compound, drug | CHIR99021 | Sigma Aldrich | Cat. #: SML1046 | (3 µM) |
| Chemical compound, drug | CCl4 | Sigma Aldrich | Cat. #: 319961 | |
| Chemical compound, drug | Tamoxifen | Sigma Aldrich | Cat. #: T5648 | |
| Chemical compound, drug | Corn oil | Sigma Aldrich | Cat. #: C8267 | |
| Chemical compound, drug | Mayer's Hematoxylin | ScyTek Laboratories | Cat. #: HMM500 | |
| Chemical compound, drug | DAPI | Life Technologies | Cat. #: D1306 | (1 µg/mL) |
| Chemical compound, drug | TRIzol Reagent | Thermo Fisher | Cat. #: 15596026 | |
| Chemical compound, drug | cOmpleteTM, Mini EDTA-free protease inhibitor | Roche | Cat. #: 11836170001 | |
| Chemical compound, drug | DynabeadsTM Sheep Anti-Rat IgG | Invitrogen | Cat. #: 11035 | 25 µl/sample |
| Chemical compound, drug | Colagenase H from clostridium histolyticum | Millipore Sigma | Cat. #: 11074059001 | 0.5 mg/mL |
| Recombinant protein | Rspo3 | R and D Systems | Cat. #: 4120-RS-025 | (500 ng/ml) |
| Recombinant protein | Wnt2 | Abnova | Cat. #: H00007472-P01 | (500 ng/ml) |
| Recombinant protein | Wnt9b | R and D Systems | Cat. #: 3669-WN-025 | (500 ng/ml) |
| Strain Mus musculus | B6.129P2-Lyve1tm1.1(EGFP/cre)Cys/J | The Jackson Laboratory | Cat. #: JAX:012601; RRID:IMSR_JAX:012601 | |
| Strain Mus musculus | Cdh5CreERT2 | Ralf H. Adams, Max Planck Institute for Molecular Biomedicine, Münster, Germany Wang et al., 2010 | ||
| Strain Mus musculus | Tg[Cldn2-EGFP]OU78Gsat/Mmucd | Mutant Mouse Regional Resource Center [MMRRC], University of California, Davis Gong et al., 2003 | ||
| Strain Mus musculus | 129S-Wlstm1.1Lan/J | The Jackson Laboratory | Cat. # JAX:012888; RRID:IMSR_JAX:012888 | |
| Strain Mus musculus | RoB6.129S4-Gt(ROSA)26Sortm1Sor/Jsa | The Jackson Laboratory | Cat. # JAX:004077; RRID:IMSR_JAX:004077 | |
| Strain Mus musculus | Sox9CreERT2 (Tg(Sox9-cre/ERT2)1Msan/ | The Jackson Laboratory | Cat. # JAX:018829; RRID:IMSR_JAX:018829 | |
| Software | Adobe Photoshop CC | Adobe Systems | RRID:SCR_014199 | |
| Software | ImageJ | NIH https://imagej.net/ | RRID:SCR_003070 | |
| Software | GraphPad Prism 5.0 software | GraphPad Software;http://www.graphpad.com | RRID:SCR_002798 |