TABLE 2.

Oligonucleotides used in this study

Name	Sequence (5′ to 3′)	Description
qRT_zupT_F	ccagtttattatgccacaggag	qRT-PCR forward primer for zupT
qRT_zupT_R	tcgctcctaaaggctcagac	qRT-PCR reverse primer for zupT
qRT_rpoB_F	tgctgttgaaatggttcctg	qRT-PCR housekeeping gene forward primer
qRT_rpoB_R	cggttggcatcatcattttc	qRT-PCR housekeeping gene reverse primer
R20291_zupT _F	agcttaggattttctgctggtgt	Forward primer to check for intron insertion into zupT
R20291_zupT_R	tcgctcctaaaggctcagac	Reverse primer to check for intron insertion into zupT