Table 1.

Currently known HCMV miRNAs and/or potential miRNAs targets and their functions

Pre-miRNA names	Mature miRNA names	Sequences	Targets	Main Function
mir-UL112	miR-UL112-3p	aagugacggugagauccaggcu	UL114 [14]	escape immune elimination and induce viral latency
			BCLAF1 [15]
			MICB [16]
			MICA [17]
			UL112/113 [18]
			UL120/121 [18]
			IE72 [19]
			IRF1 [20]
			VAMP3 [21]
			RAB5C [21]
			RAB11A [21]
			SNAP23 [21]
			CDC42 [21]
			ATG5 [22]
			IKKα/β [23]
			IL32 [24]
			TLR2 [25]
	miR-UL112-5p	ccuccggaucacaugguuacuca	ERAP1 [26]	escape immune response
			CASP3 [22]
mir-UL148D	miR-UL148D	ucguccuccccuucuucaccg	RANTES [27]	escape immune response and regulate apoptosis of host cells
			IEX-1 [28]
			ACVR1B [29]
			ERN1 [30]
			PHAP1 [30]
mir-UL22A	miR-UL22A-3p	ucaccagaaugcuaguuuguag	CASP7 [22]	participate in cell differentiation and immunity
			SMAD3 [31]
	miR-UL22A-5p	uaacuagccuucccgugaga	BMPR2 [32]
			CASP3 [22]
			SMAD3 [31]
mir-UL36	miR-UL36-3p	uuuccagguguuuucaacgugc	CDK6 [22]	N/A
			FAS [22]
	miR-UL36-5p	ucguugaagacaccuggaaaga	UL138 [33]	contribute to HCMV replication
			SLC25A6 (ANT3) [34]
mir-UL59	miR-UL59	guucucucgcucgucaugccgu	ULBP1 [35]	escape immune elimination
mir-UL69	miR-UL69	ccagaggcuaagccgaaaccg	N/A	N/A
mir-UL70	miR-UL70-3p	ggggaugggcuggcgcgcgg	MOAP1 [29]	inhibit mitochondria-induced apoptosis and the antiviral mechanism
			ERN1 [29]
			PHAP1 [29]
	miR-UL70-5p	ugcgucucggccucguccaga	N/A	N/A
mir-US4	miR-US4-3p	ugacagcccgcuacaccucu	ERAP 1[36]	N/A
			CASP7 [22]
			CDK6 [22]
	miR-US4-5p	uggacgugcagggggaugucug	PAK2 [37]	inhibit antigen presentation
			CASP2 [22]
			ERAP1 [36]
			QARS [36]
mir-US5-1	miR-US5-1	ugacaagccugacgagagcgu	US7 [38]	escape the immune system; increase the production of infectious particles during the late phase of infection;
			VAMP3 [21]
			RAB5C [21]
			RAB11A [21]
			SNAP23 [21]
			CDC42 [21]
			CDK6 [22]
			FAS [22]
			Gemini [39]
			IKKα/β [23]
mir-US5-2	miR-US5-2-3p	uaugauaggugugacgaugucu	US7 [38]
			VAMP3 [21]
			RAB5C [21]
			RAB11A [21]
			SNAP23 [21]
			CDC42 [21]
			CDK6 [22]
			FAS [22]
			NAB1 [31]
	miR-US5-2-5p	cuuucgccacaccuauccugaaag	N/A	N/A
mir-US22	miR-US22-3p	ucgccggccgcgcuguaaccagg	US22 [40]	N/A
	miR-US22-5p	uguuucagcguguguccgcggg	US22 [40]	regulate apoptosis of host cells
			ATG5 [22]
			EGR1 [41]
mir-US25-1	miR-US25-1-3p	uccgaacgcuaggucgguucu	CDK6 [22]	reduce viral DNA synthesis
	miR-US25-1-5p	aaccgcucaguggcucggacc	Cyclin E2 [42]
			BRCC 3[42]
			EID1 [42]
			MAPRE2 [42]
			CD147 [42]
			TRIM28 [42]
mir-US25-2	miR-US25-2-3p	auccacuuggagagcucccgcggu	CASP3 [22]
			CDK6 [22]
			eIF4A1 [43]
	miR-US25-2-5p	agcggucuguucagguggauga	N/A
mir-US29	miR-US29-3p	cccacgguccgggcacaauca	N/A	N/A
	miR-US29-5p	uggaugugcucggaccgugacg	ATG5 [22]	regulate apoptosis of host cells
mir-US33	miR-US33-3p	ucacgguccgagcacauccaa	US29 [44]	N/A
	miR-US33-5p	gauugugcccggaccgugggcg	STX3 [45]	decreases the number of HCMV DNA copies
			CCND1 [22]
15	26		N/A=No targets or exact function were found currently)

List of pre-miRNAs and mature miRNAs. Previously reported 16 pre-miRNAs and 26 mature miRNAs encoded by HCMV were listed in this table, along with their potential targets and main functions